Starting /dee2/code/volunteer_pipeline.sh SRR5423363 current disk space = 3051173842944 free memory = 1567627676 SRR5423363 SRAfilesize 4e90cc38a47a033ce7a82e0ad07f357e SRR5423363.sra SRR5423363.sra file validated SRR5423363 is single end SRR5423363 is conventional basespace SRR5423363 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423363_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.31575 34.0 31.0 34.0 27.0 34.0 2 31.50375 34.0 31.0 34.0 27.0 34.0 3 32.36225 34.0 31.0 34.0 28.0 34.0 4 35.97325 37.0 35.0 37.0 35.0 37.0 5 36.00075 37.0 35.0 37.0 35.0 37.0 6 36.0965 37.0 35.0 37.0 35.0 37.0 7 36.116 37.0 35.0 37.0 35.0 37.0 8 36.103 37.0 35.0 37.0 35.0 37.0 9 37.8025 39.0 38.0 39.0 35.0 39.0 10 37.4715 39.0 37.0 39.0 35.0 39.0 11 37.76575 39.0 38.0 39.0 35.0 39.0 12 37.77225 39.0 38.0 39.0 35.0 39.0 13 37.73875 39.0 37.0 39.0 35.0 39.0 14 39.122 40.0 39.0 41.0 36.0 41.0 15 39.052 40.0 38.0 41.0 36.0 41.0 16 39.0375 40.0 38.0 41.0 36.0 41.0 17 38.97425 40.0 38.0 41.0 36.0 41.0 18 38.9245 40.0 38.0 41.0 36.0 41.0 19 39.07075 40.0 39.0 41.0 36.0 41.0 20 38.81925 40.0 39.0 41.0 35.0 41.0 21 38.9325 40.0 39.0 41.0 35.0 41.0 22 38.8835 40.0 38.0 41.0 35.0 41.0 23 38.877 40.0 38.0 41.0 35.0 41.0 24 38.80525 40.0 38.0 41.0 35.0 41.0 25 38.5865 40.0 38.0 41.0 34.0 41.0 26 38.64075 40.0 38.0 41.0 35.0 41.0 27 38.59175 40.0 38.0 41.0 34.0 41.0 28 38.426 40.0 38.0 41.0 34.0 41.0 29 38.479 40.0 38.0 41.0 34.0 41.0 30 38.414 40.0 38.0 41.0 34.0 41.0 31 38.3285 40.0 38.0 41.0 34.0 41.0 32 38.199 40.0 38.0 41.0 33.0 41.0 33 38.24875 40.0 38.0 41.0 33.0 41.0 34 38.20175 40.0 38.0 41.0 33.0 41.0 35 38.22675 40.0 38.0 41.0 34.0 41.0 36 38.1925 40.0 38.0 41.0 33.0 41.0 37 37.8785 40.0 38.0 41.0 33.0 41.0 38 37.80075 40.0 38.0 41.0 33.0 41.0 39 37.84975 40.0 38.0 41.0 33.0 41.0 40 37.677 40.0 37.0 41.0 32.0 41.0 41 37.66975 40.0 38.0 41.0 32.0 41.0 42 37.43875 40.0 37.0 41.0 31.0 41.0 43 37.17025 40.0 37.0 41.0 31.0 41.0 44 37.37775 40.0 37.0 41.0 31.0 41.0 45 37.1065 40.0 36.0 41.0 31.0 41.0 46 36.917 40.0 36.0 41.0 30.0 41.0 47 36.846 40.0 36.0 41.0 30.0 41.0 48 36.84625 40.0 36.0 41.0 30.0 41.0 49 36.653 39.0 35.0 41.0 29.0 41.0 50 36.5795 39.0 35.0 41.0 29.0 41.0 51 36.6005 39.0 35.0 41.0 30.0 41.0 52 34.46075 38.0 33.0 40.0 23.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.0 21 3.0 22 6.0 23 5.0 24 8.0 25 10.0 26 21.0 27 21.0 28 32.0 29 39.0 30 49.0 31 88.0 32 88.0 33 125.0 34 143.0 35 210.0 36 281.0 37 439.0 38 806.0 39 1616.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.8341884958142 11.504185795301106 6.346205779098028 44.31541992978666 2 24.224999999999998 13.0 34.625 28.15 3 21.95 18.475 23.075000000000003 36.5 4 24.375 25.95 22.275 27.400000000000002 5 24.15 32.125 22.25 21.475 6 19.125 33.225 24.3 23.35 7 15.024999999999999 23.474999999999998 41.725 19.775000000000002 8 17.125 22.8 30.775000000000002 29.299999999999997 9 17.625 21.65 33.074999999999996 27.650000000000002 10 18.675 37.875 24.375 19.075 11 22.0 28.7 21.0 28.299999999999997 12 21.9 24.75 26.525 26.825 13 20.225 27.375 26.900000000000002 25.5 14 20.5 27.725 26.3 25.474999999999998 15 20.45 27.6 26.400000000000002 25.55 16 20.4 27.725 26.674999999999997 25.2 17 21.4 27.150000000000002 26.5 24.95 18 21.175 26.35 26.1 26.375 19 21.725 26.8 25.1 26.375 20 19.325 27.150000000000002 27.275 26.25 21 20.200000000000003 26.0 27.500000000000004 26.3 22 20.25 28.4 25.924999999999997 25.424999999999997 23 20.474999999999998 27.500000000000004 24.525 27.500000000000004 24 21.925 26.900000000000002 25.025 26.150000000000002 25 21.95 27.025 25.575 25.45 26 22.85 25.25 25.825 26.075 27 22.075 27.05 25.174999999999997 25.7 28 21.349999999999998 27.375 26.8 24.474999999999998 29 22.05 26.924999999999997 25.8 25.224999999999998 30 21.224999999999998 27.075 25.900000000000002 25.8 31 21.875 27.250000000000004 25.525 25.35 32 21.575 27.025 25.95 25.45 33 21.525 25.35 26.650000000000002 26.474999999999998 34 21.425 27.3 25.674999999999997 25.6 35 20.349999999999998 26.575 26.825 26.25 36 22.3 26.150000000000002 24.4 27.150000000000002 37 21.2 27.3 25.174999999999997 26.325 38 22.275 26.775 24.224999999999998 26.724999999999998 39 21.45 26.25 24.775 27.525 40 21.175 25.924999999999997 26.400000000000002 26.5 41 21.7 25.95 26.85 25.5 42 21.55 25.0 27.35 26.1 43 21.55 27.825 25.35 25.275 44 21.45 27.1 25.55 25.900000000000002 45 21.825 26.1 25.525 26.55 46 22.025 26.05 26.075 25.85 47 21.625 27.250000000000004 25.3 25.825 48 21.099999999999998 27.450000000000003 25.1 26.35 49 20.8 27.775 25.074999999999996 26.35 50 22.675 26.650000000000002 23.625 27.05 51 22.2 25.4 26.424999999999997 25.974999999999998 52 22.400000000000002 26.5 24.7 26.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 2.5 17 4.0 18 4.5 19 5.0 20 6.5 21 8.0 22 10.5 23 13.0 24 14.0 25 15.0 26 22.0 27 29.0 28 39.5 29 50.0 30 59.0 31 68.0 32 85.5 33 103.0 34 122.0 35 141.0 36 153.0 37 165.0 38 194.0 39 224.5 40 226.0 41 253.5 42 281.0 43 280.5 44 280.0 45 282.0 46 284.0 47 279.0 48 274.0 49 286.0 50 298.0 51 289.5 52 281.0 53 280.0 54 279.0 55 250.5 56 222.0 57 210.5 58 199.0 59 180.0 60 161.0 61 144.0 62 127.0 63 106.5 64 69.5 65 53.0 66 49.5 67 46.0 68 32.0 69 18.0 70 16.5 71 15.0 72 16.0 73 17.0 74 13.0 75 9.0 76 7.0 77 5.0 78 4.0 79 3.0 80 3.0 81 3.0 82 3.5 83 4.0 84 2.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 97.12493465760585 92.9 2 1.986408782017773 3.8 3 0.575013068478829 1.6500000000000001 4 0.18295870360690017 0.7000000000000001 5 0.026136957658128592 0.125 6 0.026136957658128592 0.15 7 0.026136957658128592 0.17500000000000002 8 0.026136957658128592 0.2 9 0.0 0.0 >10 0.026136957658128592 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 12 0.3 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 8 0.2 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 6 0.15 No Hit CTCAGAGACCCGTTCCAAATCACACACACAGGGGCACACAGTAGCCCACGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra Read 200000 spots for SRR5423363.sra Written 200000 spots for SRR5423363.sra SRR ids: ['SRR5423363.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__ygy88kd SRR5423363.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423363 file size 703974 SRR5423363 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423363 SRR5423363_1.fastq Input file: SRR5423363_1.fastq trimmed: SRR5423363-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 01:09:15 2025 >> started Thu Feb 13 01:10:22 2025 >> done (67.203s) 4000000 reads processed; of these: 104 ( 0.00%) short reads filtered out after trimming by size control 77 ( 0.00%) empty reads filtered out after trimming by size control 3999819 (100.00%) reads available; of these: 97804 ( 2.45%) trimmed reads available after processing 3902015 (97.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 4 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 6 0.00% 25 6 0.00% 26 3 0.00% 27 8 0.00% 28 15 0.00% 29 26 0.00% 30 17 0.00% 31 42 0.00% 32 24 0.00% 33 44 0.00% 34 46 0.00% 35 48 0.00% 36 49 0.00% 37 74 0.00% 38 86 0.00% 39 99 0.00% 40 111 0.00% 41 131 0.00% 42 206 0.01% 43 252 0.01% 44 328 0.01% 45 477 0.01% 46 781 0.02% 47 1189 0.03% 48 2079 0.05% 49 4438 0.11% 50 12370 0.31% 51 74836 1.87% 52 3902015 97.55% 3999819 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=13.78 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=2.7 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCC Started job on | Feb 13 01:15:04 Started mapping on | Feb 13 01:15:17 Finished on | Feb 13 01:17:54 Mapping speed, Million of reads per hour | 91.72 Number of input reads | 3999819 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3197429 Uniquely mapped reads % | 79.94% Average mapped length | 51.77 Number of splices: Total | 297468 Number of splices: Annotated (sjdb) | 290748 Number of splices: GT/AG | 290260 Number of splices: GC/AG | 5153 Number of splices: AT/AC | 710 Number of splices: Non-canonical | 1345 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408081 % of reads mapped to multiple loci | 10.20% Number of reads mapped to too many loci | 282567 % of reads mapped to too many loci | 7.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 394309 394309 394309 N_multimapping 408081 408081 408081 N_noFeature 538034 3122137 604619 N_ambiguous 17922 132 9102 UnstrandedReadsAssigned:2641473 PositiveStrandReadsAssigned:75160 NegativeStrandReadsAssigned:2583708 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423363 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423363-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,819 reads, 3,047,462 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR5423363.ke.tsv 34699 SRR5423363.se.tsv 87100 total ==> SRR5423363.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 311 58.1217 Potri.005G024800.1.v4.1 1035 936 25 9.57893 Potri.004G059700.1.v4.1 961 862 2 0.8321 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 70.0168 8.82929 Potri.016G087400.1.v4.1 270 171 10 20.9728 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 11 2.35662 Potri.012G127500.1.v4.1 977 878 108 44.1146 ==> SRR5423363.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 38 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423363 completed mapping pipeline successfully