Starting /dee2/code/volunteer_pipeline.sh SRR5423364 current disk space = 3051061559296 free memory = 1567190332 SRR5423364 SRAfilesize c740097f235d2f27af557c3afca27803 SRR5423364.sra SRR5423364.sra file validated SRR5423364 is single end SRR5423364 is conventional basespace SRR5423364 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423364_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7375 31.0 31.0 34.0 30.0 34.0 2 31.84625 31.0 31.0 34.0 30.0 34.0 3 31.8805 33.0 31.0 34.0 30.0 34.0 4 35.011 37.0 35.0 37.0 32.0 37.0 5 35.4145 37.0 35.0 37.0 33.0 37.0 6 35.1725 37.0 35.0 37.0 32.0 37.0 7 35.16125 37.0 35.0 37.0 32.0 37.0 8 34.9825 37.0 35.0 37.0 32.0 37.0 9 37.02 39.0 37.0 39.0 33.0 39.0 10 37.02 39.0 37.0 39.0 33.0 39.0 11 36.87175 39.0 37.0 39.0 33.0 39.0 12 36.9505 39.0 37.0 39.0 33.0 39.0 13 36.7915 39.0 37.0 39.0 32.0 39.0 14 37.806 40.0 37.0 41.0 32.0 41.0 15 37.89775 40.0 37.0 41.0 32.0 41.0 16 37.774 40.0 37.0 41.0 32.0 41.0 17 37.717 40.0 37.0 41.0 32.0 41.0 18 37.502 39.0 36.0 41.0 32.0 41.0 19 37.82925 40.0 37.0 41.0 32.0 41.0 20 37.59525 39.0 37.0 41.0 32.0 41.0 21 37.87125 40.0 37.0 41.0 33.0 41.0 22 37.963 40.0 37.0 41.0 32.0 41.0 23 37.81575 40.0 37.0 41.0 32.0 41.0 24 38.00925 40.0 37.0 41.0 33.0 41.0 25 37.8585 40.0 37.0 41.0 33.0 41.0 26 37.84725 40.0 37.0 41.0 32.0 41.0 27 37.6865 40.0 37.0 41.0 32.0 41.0 28 37.7515 40.0 37.0 41.0 32.0 41.0 29 37.85675 40.0 37.0 41.0 32.0 41.0 30 37.42975 40.0 37.0 41.0 31.0 41.0 31 37.50275 40.0 37.0 41.0 31.0 41.0 32 37.407 40.0 36.0 41.0 31.0 41.0 33 37.57725 40.0 37.0 41.0 32.0 41.0 34 37.4655 40.0 37.0 41.0 31.0 41.0 35 37.399 40.0 37.0 41.0 31.0 41.0 36 37.56775 39.0 37.0 41.0 32.0 41.0 37 37.29225 39.0 37.0 41.0 31.0 41.0 38 37.42175 39.0 37.0 41.0 31.0 41.0 39 37.286 39.0 36.0 41.0 31.0 41.0 40 37.37525 39.0 37.0 41.0 31.0 41.0 41 37.3635 39.0 36.0 41.0 31.0 41.0 42 37.23975 39.0 36.0 41.0 31.0 41.0 43 37.116 39.0 36.0 41.0 31.0 41.0 44 37.05775 39.0 36.0 41.0 31.0 41.0 45 36.79475 39.0 35.0 41.0 30.0 41.0 46 36.71125 39.0 35.0 40.0 30.0 41.0 47 36.68075 39.0 35.0 40.0 30.0 41.0 48 36.59625 39.0 35.0 40.0 30.0 41.0 49 36.6685 39.0 35.0 40.0 30.0 41.0 50 36.3825 39.0 35.0 40.0 30.0 41.0 51 36.4975 39.0 35.0 40.0 30.0 41.0 52 35.5695 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1113 1 0.0 1113 2 0.0 1113 3 0.0 1113 4 0.0 1113 5 0.0 1113 6 0.0 1113 7 0.0 1113 8 0.0 1113 9 0.0 1113 10 0.0 1113 11 0.0 1113 12 0.0 1113 13 0.0 1113 14 0.0 1113 15 0.0 1113 16 0.0 1113 17 0.0 1113 18 0.0 1113 19 0.0 1113 20 0.0 1113 21 0.0 1113 22 0.0 1113 23 0.0 1113 24 0.0 1113 25 0.0 1113 26 0.0 1113 27 0.0 1113 28 0.0 1113 29 0.0 1113 30 0.0 1113 31 0.0 1113 32 0.0 1113 33 0.0 1113 34 0.0 1113 35 0.0 1113 36 0.0 1113 37 0.0 1113 38 0.0 1113 39 0.0 1113 40 0.0 1113 41 0.0 1113 42 0.0 1113 43 0.0 1113 44 0.0 1113 45 0.0 1113 46 0.0 1113 47 0.0 1113 48 0.0 1113 49 0.0 1113 50 0.0 1113 51 0.0 1113 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 3.0 23 3.0 24 3.0 25 16.0 26 31.0 27 31.0 28 40.0 29 55.0 30 86.0 31 104.0 32 141.0 33 186.0 34 223.0 35 284.0 36 374.0 37 455.0 38 727.0 39 1232.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.43114672008012 12.368552829243866 6.509764646970456 43.69053580370556 2 22.650000000000002 15.0 34.425 27.925 3 20.974999999999998 18.05 23.150000000000002 37.824999999999996 4 24.875 26.775 20.0 28.349999999999998 5 24.725 31.525 23.225 20.525 6 18.9 33.0 24.975 23.125 7 14.85 23.724999999999998 43.0 18.425 8 17.175 22.650000000000002 32.025 28.15 9 18.625 21.425 32.324999999999996 27.625 10 18.6 37.65 24.325 19.425 11 21.825 27.85 23.400000000000002 26.924999999999997 12 21.175 23.75 26.974999999999998 28.1 13 19.275000000000002 27.750000000000004 26.950000000000003 26.025 14 19.525000000000002 27.474999999999998 27.650000000000002 25.35 15 20.325 27.125 26.224999999999998 26.325 16 20.200000000000003 28.625 25.650000000000002 25.525 17 21.224999999999998 27.375 25.95 25.45 18 20.474999999999998 26.575 26.650000000000002 26.3 19 21.025 26.75 25.4 26.825 20 20.200000000000003 27.750000000000004 27.1 24.95 21 19.900000000000002 27.950000000000003 26.5 25.650000000000002 22 21.55 27.375 25.825 25.25 23 19.925 28.199999999999996 26.075 25.8 24 20.724999999999998 27.125 25.775 26.375 25 20.549999999999997 28.349999999999998 25.650000000000002 25.45 26 21.0 26.700000000000003 26.05 26.25 27 21.725 27.3 26.0 24.975 28 21.55 27.625 26.674999999999997 24.15 29 21.175 26.0 27.450000000000003 25.374999999999996 30 21.65 26.85 26.275 25.224999999999998 31 22.075 27.425 25.424999999999997 25.074999999999996 32 21.9 27.375 26.55 24.175 33 20.849999999999998 26.700000000000003 25.8 26.650000000000002 34 21.15 27.400000000000002 26.3 25.15 35 22.325 25.724999999999998 25.374999999999996 26.575 36 20.825 28.199999999999996 25.1 25.874999999999996 37 20.625 27.325 25.6 26.450000000000003 38 22.15 26.875 24.4 26.575 39 21.175 25.974999999999998 25.624999999999996 27.224999999999998 40 20.9 26.6 26.3 26.200000000000003 41 21.5 26.174999999999997 25.724999999999998 26.6 42 20.75 26.950000000000003 25.900000000000002 26.400000000000002 43 21.625 27.525 24.075 26.775 44 21.175 26.25 26.25 26.325 45 21.175 26.825 25.474999999999998 26.525 46 22.425 25.124999999999996 25.15 27.3 47 22.45 26.650000000000002 24.975 25.924999999999997 48 22.425 26.5 24.4 26.674999999999997 49 20.75 25.924999999999997 26.375 26.950000000000003 50 21.65 27.224999999999998 25.25 25.874999999999996 51 21.95 24.9 26.35 26.8 52 22.175 26.474999999999998 25.45 25.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 1.5 12 3.0 13 2.0 14 0.5 15 0.0 16 1.0 17 2.0 18 2.0 19 2.0 20 4.5 21 7.0 22 11.5 23 16.0 24 20.0 25 24.0 26 30.0 27 36.0 28 42.5 29 49.0 30 59.5 31 70.0 32 83.0 33 96.0 34 116.5 35 137.0 36 164.0 37 191.0 38 181.0 39 220.0 40 269.0 41 262.5 42 256.0 43 268.0 44 280.0 45 282.0 46 284.0 47 292.5 48 301.0 49 291.0 50 281.0 51 287.5 52 294.0 53 297.0 54 300.0 55 255.5 56 211.0 57 197.5 58 184.0 59 174.0 60 164.0 61 146.0 62 128.0 63 107.0 64 71.0 65 56.0 66 46.5 67 37.0 68 27.5 69 18.0 70 14.5 71 11.0 72 16.0 73 21.0 74 15.0 75 9.0 76 5.5 77 2.0 78 2.0 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 97.24986904138292 92.825 2 1.7024620220010476 3.25 3 0.7071765322158199 2.025 4 0.13095861707700368 0.5 5 0.05238344683080147 0.25 6 0.026191723415400735 0.15 7 0.05238344683080147 0.35000000000000003 8 0.05238344683080147 0.4 9 0.0 0.0 >10 0.026191723415400735 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 10 0.25 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 8 0.2 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 8 0.2 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 7 0.17500000000000002 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 7 0.17500000000000002 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 6 0.15 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra Read 200000 spots for SRR5423364.sra Written 200000 spots for SRR5423364.sra SRR ids: ['SRR5423364.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k5bxlu9j SRR5423364.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423364 file size 704034 SRR5423364 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423364 SRR5423364_1.fastq Input file: SRR5423364_1.fastq trimmed: SRR5423364-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 01:03:42 2025 >> started Thu Feb 13 01:04:59 2025 >> done (77.186s) 4000000 reads processed; of these: 119 ( 0.00%) short reads filtered out after trimming by size control 100 ( 0.00%) empty reads filtered out after trimming by size control 3999781 (99.99%) reads available; of these: 98227 ( 2.46%) trimmed reads available after processing 3901554 (97.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 5 0.00% 24 3 0.00% 25 3 0.00% 26 6 0.00% 27 13 0.00% 28 18 0.00% 29 15 0.00% 30 20 0.00% 31 26 0.00% 32 51 0.00% 33 50 0.00% 34 44 0.00% 35 53 0.00% 36 56 0.00% 37 71 0.00% 38 63 0.00% 39 96 0.00% 40 112 0.00% 41 144 0.00% 42 164 0.00% 43 237 0.01% 44 383 0.01% 45 516 0.01% 46 755 0.02% 47 1432 0.04% 48 2365 0.06% 49 4502 0.11% 50 12344 0.31% 51 74671 1.87% 52 3901554 97.54% 3999781 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.21 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=16.26 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.9 sequence=AAAAAAAAATACGTATTTTTTTATAGGATTAGATTAAACAAATCAAATATAGGATTAAACAAAAGGATTCGCAAATAAAAGTGCTAATGCTACAACCAGTCCATAAATTGTTAAAGCTTCCATAAAAGCCAGACTAAGCAATAAAGTACCTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTGGCCCGCAGCAGTACCTTGACCAACCCCAGGTCCAATAGAAGCAAGCCCAAC Started job on | Feb 13 01:12:39 Started mapping on | Feb 13 01:12:46 Finished on | Feb 13 01:17:54 Mapping speed, Million of reads per hour | 46.75 Number of input reads | 3999781 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3196585 Uniquely mapped reads % | 79.92% Average mapped length | 51.77 Number of splices: Total | 296780 Number of splices: Annotated (sjdb) | 290035 Number of splices: GT/AG | 289416 Number of splices: GC/AG | 5297 Number of splices: AT/AC | 705 Number of splices: Non-canonical | 1362 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408296 % of reads mapped to multiple loci | 10.21% Number of reads mapped to too many loci | 282311 % of reads mapped to too many loci | 7.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 394900 394900 394900 N_multimapping 408296 408296 408296 N_noFeature 537587 3121865 603583 N_ambiguous 17741 133 8909 UnstrandedReadsAssigned:2641257 PositiveStrandReadsAssigned:74587 NegativeStrandReadsAssigned:2584093 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423364 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423364-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,781 reads, 3,023,930 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR5423364.ke.tsv 34699 SRR5423364.se.tsv 87100 total ==> SRR5423364.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 302 56.9463 Potri.005G024800.1.v4.1 1035 936 33 12.7577 Potri.004G059700.1.v4.1 961 862 3 1.25935 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 72.659 9.24471 Potri.016G087400.1.v4.1 270 171 10 21.1611 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15.6809 3.38961 Potri.012G127500.1.v4.1 977 878 118 48.6319 ==> SRR5423364.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 39 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423364 completed mapping pipeline successfully