Starting /dee2/code/volunteer_pipeline.sh SRR5423365 current disk space = 3051176337408 free memory = 1566497280 SRR5423365 SRAfilesize 5d37b7a25cc7b510bffd999738b39ddd SRR5423365.sra SRR5423365.sra file validated SRR5423365 is single end SRR5423365 is conventional basespace SRR5423365 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423365_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.20075 34.0 31.0 34.0 30.0 34.0 2 32.2995 34.0 31.0 34.0 30.0 34.0 3 32.36375 34.0 31.0 34.0 30.0 34.0 4 35.78125 37.0 35.0 37.0 33.0 37.0 5 35.66675 37.0 35.0 37.0 33.0 37.0 6 35.7855 37.0 35.0 37.0 33.0 37.0 7 35.86275 37.0 35.0 37.0 35.0 37.0 8 35.843 37.0 35.0 37.0 35.0 37.0 9 37.53025 39.0 37.0 39.0 35.0 39.0 10 37.57625 39.0 37.0 39.0 35.0 39.0 11 37.419 39.0 37.0 39.0 34.0 39.0 12 37.464 39.0 37.0 39.0 35.0 39.0 13 37.31325 39.0 37.0 39.0 33.0 39.0 14 38.6985 40.0 38.0 41.0 34.0 41.0 15 38.681 40.0 38.0 41.0 34.0 41.0 16 38.40025 40.0 38.0 41.0 34.0 41.0 17 38.196 40.0 38.0 41.0 33.0 41.0 18 38.37875 40.0 38.0 41.0 33.0 41.0 19 38.44075 40.0 38.0 41.0 34.0 41.0 20 38.5805 40.0 38.0 41.0 34.0 41.0 21 38.56475 40.0 38.0 41.0 34.0 41.0 22 38.56975 40.0 38.0 41.0 34.0 41.0 23 38.66275 40.0 38.0 41.0 35.0 41.0 24 38.70275 40.0 38.0 41.0 34.0 41.0 25 38.76525 40.0 38.0 41.0 35.0 41.0 26 38.526 40.0 38.0 41.0 34.0 41.0 27 38.16425 40.0 38.0 41.0 33.0 41.0 28 38.00625 40.0 38.0 41.0 33.0 41.0 29 38.2705 40.0 38.0 41.0 34.0 41.0 30 38.39075 40.0 38.0 41.0 34.0 41.0 31 38.31475 40.0 38.0 41.0 34.0 41.0 32 38.2265 40.0 38.0 41.0 33.0 41.0 33 37.74 40.0 37.0 41.0 32.0 41.0 34 38.06475 40.0 38.0 41.0 33.0 41.0 35 37.94525 40.0 38.0 41.0 33.0 41.0 36 38.035 40.0 38.0 41.0 33.0 41.0 37 37.894 40.0 37.0 41.0 33.0 41.0 38 37.74225 40.0 37.0 41.0 32.0 41.0 39 37.82525 40.0 37.0 41.0 33.0 41.0 40 37.8105 40.0 37.0 41.0 33.0 41.0 41 37.69775 40.0 37.0 41.0 32.0 41.0 42 37.69425 40.0 37.0 41.0 32.0 41.0 43 37.3355 40.0 36.0 41.0 31.0 41.0 44 37.33975 40.0 36.0 41.0 31.0 41.0 45 37.3335 40.0 36.0 41.0 31.0 41.0 46 37.21375 39.0 36.0 41.0 31.0 41.0 47 37.01375 39.0 36.0 41.0 31.0 41.0 48 36.95625 39.0 35.0 41.0 31.0 41.0 49 37.122 39.0 36.0 41.0 31.0 41.0 50 37.018 39.0 35.0 41.0 31.0 41.0 51 36.7475 39.0 35.0 41.0 30.0 41.0 52 35.5805 38.0 34.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1209 1 0.0 1209 2 0.0 1209 3 0.0 1209 4 0.0 1209 5 0.0 1209 6 0.0 1209 7 0.0 1209 8 0.0 1209 9 0.0 1209 10 0.0 1209 11 0.0 1209 12 0.0 1209 13 0.0 1209 14 0.0 1209 15 0.0 1209 16 0.0 1209 17 0.0 1209 18 0.0 1209 19 0.0 1209 20 0.0 1209 21 0.0 1209 22 0.0 1209 23 0.0 1209 24 0.0 1209 25 0.0 1209 26 0.0 1209 27 0.0 1209 28 0.0 1209 29 0.0 1209 30 0.0 1209 31 0.0 1209 32 0.0 1209 33 0.0 1209 34 0.0 1209 35 0.0 1209 36 0.0 1209 37 0.0 1209 38 0.0 1209 39 0.0 1209 40 0.0 1209 41 0.0 1209 42 0.0 1209 43 0.0 1209 44 0.0 1209 45 0.0 1209 46 0.0 1209 47 0.0 1209 48 0.0 1209 49 0.0 1209 50 0.0 1209 51 0.0 1209 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 2.0 23 9.0 24 7.0 25 10.0 26 16.0 27 18.0 28 27.0 29 46.0 30 74.0 31 71.0 32 114.0 33 138.0 34 146.0 35 228.0 36 311.0 37 450.0 38 709.0 39 1613.0 40 8.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.0555833750626 13.169754631947923 5.883825738607912 43.89083625438157 2 22.900000000000002 15.325 34.300000000000004 27.474999999999998 3 23.5 18.825 22.6 35.075 4 25.174999999999997 26.3 21.75 26.775 5 23.275000000000002 31.275 23.925 21.525 6 19.25 33.525 23.45 23.775 7 15.299999999999999 24.75 41.075 18.875 8 18.3 23.549999999999997 30.325000000000003 27.825 9 19.225 21.375 32.925 26.474999999999998 10 18.125 38.324999999999996 25.124999999999996 18.425 11 22.2 28.125 22.725 26.950000000000003 12 21.825 24.0 28.025 26.150000000000002 13 19.6 26.724999999999998 27.950000000000003 25.724999999999998 14 20.1 27.55 26.900000000000002 25.45 15 20.724999999999998 26.700000000000003 26.875 25.7 16 20.9 26.424999999999997 26.674999999999997 26.0 17 21.925 27.025 24.95 26.1 18 19.325 27.85 27.125 25.7 19 21.375 27.725 25.825 25.074999999999996 20 21.875 25.525 26.375 26.224999999999998 21 20.25 26.075 26.05 27.625 22 19.75 28.975 26.474999999999998 24.8 23 19.925 27.1 25.674999999999997 27.3 24 21.125 27.025 27.025 24.825 25 20.25 26.400000000000002 26.525 26.825 26 22.025 25.974999999999998 26.825 25.174999999999997 27 22.650000000000002 26.85 24.575 25.924999999999997 28 21.125 27.700000000000003 27.224999999999998 23.95 29 23.1 25.75 26.55 24.6 30 21.45 26.325 25.85 26.375 31 21.875 26.875 27.400000000000002 23.849999999999998 32 23.075000000000003 25.2 25.7 26.025 33 20.825 26.125 25.974999999999998 27.075 34 20.825 27.900000000000002 24.55 26.724999999999998 35 20.849999999999998 26.700000000000003 26.174999999999997 26.275 36 21.475 25.575 25.624999999999996 27.325 37 20.599999999999998 27.650000000000002 26.125 25.624999999999996 38 21.675 27.500000000000004 24.224999999999998 26.6 39 21.7 25.174999999999997 26.174999999999997 26.950000000000003 40 21.4 27.175 25.95 25.474999999999998 41 20.424999999999997 27.775 25.424999999999997 26.375 42 21.775 26.224999999999998 26.650000000000002 25.35 43 21.7 27.35 25.025 25.924999999999997 44 21.0 27.125 25.6 26.275 45 21.7 24.875 26.200000000000003 27.224999999999998 46 22.35 26.950000000000003 24.85 25.85 47 22.825 26.05 24.474999999999998 26.650000000000002 48 22.125 26.974999999999998 25.2 25.7 49 21.85546386596649 26.556639159789945 24.23105776444111 27.35683920980245 50 22.25 27.05 23.875 26.825 51 20.930232558139537 26.731682920730183 25.28132033008252 27.056764191047762 52 22.2 27.275 24.625 25.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 4.0 16 2.5 17 1.0 18 3.0 19 5.0 20 7.0 21 9.0 22 12.0 23 15.0 24 13.5 25 12.0 26 20.0 27 28.0 28 39.0 29 50.0 30 55.5 31 61.0 32 72.5 33 84.0 34 102.0 35 120.0 36 141.5 37 163.0 38 199.5 39 256.5 40 277.0 41 267.0 42 257.0 43 270.0 44 283.0 45 288.0 46 293.0 47 290.5 48 288.0 49 301.5 50 315.0 51 308.5 52 302.0 53 297.5 54 293.0 55 233.0 56 173.0 57 174.5 58 176.0 59 177.5 60 179.0 61 154.5 62 130.0 63 104.0 64 68.0 65 58.0 66 47.5 67 37.0 68 27.5 69 18.0 70 17.5 71 17.0 72 17.0 73 17.0 74 13.0 75 9.0 76 6.5 77 4.0 78 3.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.025 50 0.0 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.375 #Duplication Level Percentage of deduplicated Percentage of total 1 97.11664482306685 92.625 2 2.0445609436435124 3.9 3 0.41939711664482304 1.2 4 0.2621231979030144 1.0 5 0.02621231979030144 0.125 6 0.07863695937090433 0.44999999999999996 7 0.0 0.0 8 0.02621231979030144 0.2 9 0.0 0.0 >10 0.02621231979030144 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 20 0.5 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 8 0.2 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 6 0.15 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 6 0.15 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 6 0.15 No Hit CCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra Read 200000 spots for SRR5423365.sra Written 200000 spots for SRR5423365.sra SRR ids: ['SRR5423365.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8zverb92 SRR5423365.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423365 file size 703966 SRR5423365 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423365 SRR5423365_1.fastq Input file: SRR5423365_1.fastq trimmed: SRR5423365-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 01:14:53 2025 >> started Thu Feb 13 01:17:55 2025 >> done (181.618s) 4000000 reads processed; of these: 127 ( 0.00%) short reads filtered out after trimming by size control 79 ( 0.00%) empty reads filtered out after trimming by size control 3999794 (99.99%) reads available; of these: 78094 ( 1.95%) trimmed reads available after processing 3921700 (98.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 3 0.00% 21 0 0.00% 22 1 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 1 0.00% 27 7 0.00% 28 11 0.00% 29 10 0.00% 30 16 0.00% 31 18 0.00% 32 34 0.00% 33 28 0.00% 34 37 0.00% 35 34 0.00% 36 44 0.00% 37 46 0.00% 38 62 0.00% 39 69 0.00% 40 89 0.00% 41 116 0.00% 42 132 0.00% 43 167 0.00% 44 231 0.01% 45 360 0.01% 46 532 0.01% 47 934 0.02% 48 1608 0.04% 49 3359 0.08% 50 9526 0.24% 51 60598 1.52% 52 3921700 98.05% 3999794 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=0.21 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=8.58 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=5.1 sequence=AAAAAAAAAATACGTATTTTTTTATAGGATTAGATTAAACAAATCAAATATAGGATTAAACAAAAGGATTCGCAAATAAAAGTGCTAATGCTACAACCAGTCCATAAATTGTTAAAGCTTCCATAAAAGCCAGACTAAGCAATAAAGTACCTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTGGCCCGCAGCAGTACCTTGACCAACCCCAGGTCCAATAGAAGCAAGCCCAAC Started job on | Feb 13 01:20:56 Started mapping on | Feb 13 01:20:56 Finished on | Feb 13 01:21:19 Mapping speed, Million of reads per hour | 626.05 Number of input reads | 3999794 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3193152 Uniquely mapped reads % | 79.83% Average mapped length | 51.77 Number of splices: Total | 296682 Number of splices: Annotated (sjdb) | 290125 Number of splices: GT/AG | 289461 Number of splices: GC/AG | 5171 Number of splices: AT/AC | 698 Number of splices: Non-canonical | 1352 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407726 % of reads mapped to multiple loci | 10.19% Number of reads mapped to too many loci | 288553 % of reads mapped to too many loci | 7.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 398916 398916 398916 N_multimapping 407726 407726 407726 N_noFeature 537698 3118212 603868 N_ambiguous 17963 116 9096 UnstrandedReadsAssigned:2637491 PositiveStrandReadsAssigned:74824 NegativeStrandReadsAssigned:2580188 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423365 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423365-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,794 reads, 3,051,164 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR5423365.ke.tsv 34699 SRR5423365.se.tsv 87100 total ==> SRR5423365.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 298 55.6018 Potri.005G024800.1.v4.1 1035 936 29 11.0935 Potri.004G059700.1.v4.1 961 862 2 0.830751 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 64.3227 8.09809 Potri.016G087400.1.v4.1 270 171 11 23.0327 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 18.8609 4.03419 Potri.012G127500.1.v4.1 977 878 87 35.4791 ==> SRR5423365.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 37 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423365 completed mapping pipeline successfully