Starting /dee2/code/volunteer_pipeline.sh SRR5423366 current disk space = 3052166119424 free memory = 1581020212 SRR5423366 SRAfilesize e671be33294aee4c53d7eab25ed8eac9 SRR5423366.sra SRR5423366.sra file validated SRR5423366 is single end SRR5423366 is conventional basespace SRR5423366 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423366_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.388 34.0 31.0 34.0 30.0 34.0 2 32.5455 34.0 31.0 34.0 30.0 34.0 3 32.608 34.0 31.0 34.0 31.0 34.0 4 36.018 37.0 35.0 37.0 35.0 37.0 5 36.0155 37.0 35.0 37.0 35.0 37.0 6 35.98025 37.0 35.0 37.0 35.0 37.0 7 35.89575 37.0 35.0 37.0 35.0 37.0 8 35.989 37.0 35.0 37.0 35.0 37.0 9 37.79475 39.0 38.0 39.0 35.0 39.0 10 37.649 39.0 37.0 39.0 35.0 39.0 11 37.71725 39.0 38.0 39.0 35.0 39.0 12 37.668 39.0 37.0 39.0 35.0 39.0 13 37.6235 39.0 37.0 39.0 35.0 39.0 14 38.9875 40.0 38.0 41.0 36.0 41.0 15 38.9915 40.0 38.0 41.0 36.0 41.0 16 39.03975 40.0 38.0 41.0 36.0 41.0 17 38.91275 40.0 38.0 41.0 35.0 41.0 18 38.922 40.0 38.0 41.0 36.0 41.0 19 38.90025 40.0 38.0 41.0 35.0 41.0 20 38.892 40.0 38.0 41.0 35.0 41.0 21 38.92275 40.0 39.0 41.0 35.0 41.0 22 38.80075 40.0 38.0 41.0 35.0 41.0 23 38.70075 40.0 38.0 41.0 34.0 41.0 24 38.7165 40.0 38.0 41.0 34.0 41.0 25 38.655 40.0 38.0 41.0 34.0 41.0 26 38.60625 40.0 38.0 41.0 34.0 41.0 27 38.53575 40.0 38.0 41.0 34.0 41.0 28 38.4005 40.0 38.0 41.0 34.0 41.0 29 38.50525 40.0 38.0 41.0 34.0 41.0 30 38.41675 40.0 38.0 41.0 34.0 41.0 31 38.43025 40.0 38.0 41.0 34.0 41.0 32 38.4465 40.0 38.0 41.0 34.0 41.0 33 38.23925 40.0 38.0 41.0 34.0 41.0 34 37.983 40.0 38.0 41.0 33.0 41.0 35 38.05675 40.0 38.0 41.0 33.0 41.0 36 37.98425 40.0 38.0 41.0 33.0 41.0 37 38.01975 40.0 38.0 41.0 33.0 41.0 38 38.13875 40.0 38.0 41.0 33.0 41.0 39 37.95825 40.0 38.0 41.0 33.0 41.0 40 37.89175 40.0 38.0 41.0 33.0 41.0 41 37.866 40.0 38.0 41.0 33.0 41.0 42 37.71 40.0 37.0 41.0 32.0 41.0 43 37.43 40.0 37.0 41.0 31.0 41.0 44 37.46 40.0 37.0 41.0 31.0 41.0 45 37.318 40.0 37.0 41.0 31.0 41.0 46 37.273 40.0 37.0 41.0 31.0 41.0 47 37.12125 40.0 36.0 41.0 31.0 41.0 48 37.0635 40.0 36.0 41.0 31.0 41.0 49 37.08475 40.0 36.0 41.0 31.0 41.0 50 36.92725 40.0 36.0 41.0 30.0 41.0 51 36.75275 39.0 35.0 41.0 30.0 41.0 52 35.57075 38.0 34.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1305 1 0.0 1305 2 0.0 1305 3 0.0 1305 4 0.0 1305 5 0.0 1305 6 0.0 1305 7 0.0 1305 8 0.0 1305 9 0.0 1305 10 0.0 1305 11 0.0 1305 12 0.0 1305 13 0.0 1305 14 0.0 1305 15 0.0 1305 16 0.0 1305 17 0.0 1305 18 0.0 1305 19 0.0 1305 20 0.0 1305 21 0.0 1305 22 0.0 1305 23 0.0 1305 24 0.0 1305 25 0.0 1305 26 0.0 1305 27 0.0 1305 28 0.0 1305 29 0.0 1305 30 0.0 1305 31 0.0 1305 32 0.0 1305 33 0.0 1305 34 0.0 1305 35 0.0 1305 36 0.0 1305 37 0.0 1305 38 0.0 1305 39 0.0 1305 40 0.0 1305 41 0.0 1305 42 0.0 1305 43 0.0 1305 44 0.0 1305 45 0.0 1305 46 0.0 1305 47 0.0 1305 48 0.0 1305 49 0.0 1305 50 0.0 1305 51 0.0 1305 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 4.0 23 3.0 24 10.0 25 22.0 26 19.0 27 32.0 28 33.0 29 40.0 30 53.0 31 65.0 32 81.0 33 88.0 34 151.0 35 196.0 36 256.0 37 413.0 38 737.0 39 1786.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.30669005261839 12.678526685041344 5.863192182410423 45.151591079929844 2 23.275000000000002 14.174999999999999 34.775 27.775 3 20.674999999999997 17.224999999999998 24.65 37.45 4 24.375 25.324999999999996 21.05 29.25 5 23.75 32.15 23.5 20.599999999999998 6 20.45 32.300000000000004 24.375 22.875 7 15.45 23.474999999999998 40.849999999999994 20.225 8 17.05 23.65 30.525000000000002 28.775000000000002 9 18.275 21.05 34.975 25.7 10 18.5 37.675 24.45 19.375 11 22.900000000000002 29.099999999999998 21.85 26.150000000000002 12 21.925 23.75 26.700000000000003 27.625 13 20.3 27.150000000000002 28.299999999999997 24.25 14 20.95 27.250000000000004 26.075 25.724999999999998 15 21.4 26.125 25.674999999999997 26.8 16 19.575 27.175 25.025 28.225 17 21.625 25.974999999999998 26.200000000000003 26.200000000000003 18 20.625 26.05 27.025 26.3 19 20.5 27.250000000000004 25.624999999999996 26.625 20 20.424999999999997 27.900000000000002 26.3 25.374999999999996 21 20.130032508127034 26.481620405101275 26.581645411352838 26.806701675418854 22 20.45 26.85 27.0 25.7 23 22.925 26.924999999999997 25.05 25.1 24 21.6 27.800000000000004 24.7 25.900000000000002 25 20.8 27.500000000000004 25.35 26.35 26 21.775 27.025 25.75 25.45 27 21.725 27.200000000000003 25.724999999999998 25.35 28 21.2 27.6 27.075 24.125 29 21.75 26.400000000000002 26.200000000000003 25.650000000000002 30 21.349999999999998 27.200000000000003 25.7 25.75 31 21.6 27.650000000000002 25.35 25.4 32 22.025 27.175 25.974999999999998 24.825 33 20.95 27.275 26.125 25.650000000000002 34 20.65 26.3 26.775 26.275 35 20.95 26.400000000000002 25.2 27.450000000000003 36 20.724999999999998 26.05 25.2 28.025 37 20.775 28.375 25.275 25.575 38 23.325000000000003 26.525 24.925 25.224999999999998 39 21.275 25.0 26.174999999999997 27.55 40 20.974999999999998 27.325 26.724999999999998 24.975 41 22.35 25.324999999999996 25.474999999999998 26.85 42 21.75 25.525 25.575 27.150000000000002 43 21.475 26.775 26.075 25.674999999999997 44 21.75 26.525 25.35 26.375 45 21.0 25.525 25.3 28.175 46 22.325 25.825 26.125 25.724999999999998 47 22.25 25.575 25.75 26.424999999999997 48 21.50537634408602 26.331582895723933 24.406101525381345 27.7569392348087 49 21.80545136284071 27.806951737934483 23.58089522380595 26.806701675418854 50 23.13078269567392 25.35633908477119 24.8062015503876 26.70667666916729 51 21.825 25.0 26.974999999999998 26.200000000000003 52 22.575 27.075 22.975 27.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 1.5 17 3.0 18 5.0 19 7.0 20 7.5 21 8.0 22 8.0 23 8.0 24 15.5 25 23.0 26 27.5 27 32.0 28 37.0 29 42.0 30 50.5 31 59.0 32 85.0 33 111.0 34 120.0 35 129.0 36 143.0 37 157.0 38 181.0 39 237.5 40 270.0 41 278.5 42 287.0 43 270.5 44 254.0 45 261.0 46 268.0 47 280.5 48 293.0 49 292.5 50 292.0 51 293.5 52 295.0 53 283.5 54 272.0 55 239.0 56 206.0 57 201.5 58 197.0 59 181.0 60 165.0 61 143.5 62 122.0 63 104.5 64 74.0 65 61.0 66 51.0 67 41.0 68 35.5 69 30.0 70 24.0 71 18.0 72 18.0 73 18.0 74 18.5 75 19.0 76 12.5 77 6.0 78 6.0 79 6.0 80 4.5 81 3.0 82 2.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.025 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 96.8741791436827 92.2 2 2.2852639873916467 4.35 3 0.4990806409246125 1.425 4 0.1313370107696349 0.5 5 0.07880220646178093 0.375 6 0.026267402153926978 0.15 7 0.0 0.0 8 0.052534804307853955 0.4 9 0.0 0.0 >10 0.052534804307853955 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 14 0.35000000000000003 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 10 0.25 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 8 0.2 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 8 0.2 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 6 0.15 No Hit CTCACGAGCAAGATCACGTCCCTCATTACGAGCTTGTACACATGCTTCTAGA 5 0.125 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 5 0.125 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra Read 200000 spots for SRR5423366.sra Written 200000 spots for SRR5423366.sra SRR ids: ['SRR5423366.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fhe292dl SRR5423366.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423366 file size 703969 SRR5423366 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423366 SRR5423366_1.fastq Input file: SRR5423366_1.fastq trimmed: SRR5423366-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 02:48:45 2025 >> started Thu Feb 13 02:55:28 2025 >> done (402.642s) 4000000 reads processed; of these: 113 ( 0.00%) short reads filtered out after trimming by size control 74 ( 0.00%) empty reads filtered out after trimming by size control 3999813 (100.00%) reads available; of these: 66426 ( 1.66%) trimmed reads available after processing 3933387 (98.34%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 2 0.00% 28 3 0.00% 29 4 0.00% 30 7 0.00% 31 6 0.00% 32 9 0.00% 33 19 0.00% 34 21 0.00% 35 14 0.00% 36 25 0.00% 37 25 0.00% 38 30 0.00% 39 41 0.00% 40 47 0.00% 41 63 0.00% 42 74 0.00% 43 97 0.00% 44 144 0.00% 45 202 0.01% 46 374 0.01% 47 566 0.01% 48 1117 0.03% 49 2427 0.06% 50 7498 0.19% 51 53592 1.34% 52 3933387 98.34% 3999813 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=8.85 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.0 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCCCCGTCT Started job on | Feb 13 03:03:31 Started mapping on | Feb 13 03:03:53 Finished on | Feb 13 03:52:42 Mapping speed, Million of reads per hour | 4.92 Number of input reads | 3999813 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3191879 Uniquely mapped reads % | 79.80% Average mapped length | 51.78 Number of splices: Total | 298145 Number of splices: Annotated (sjdb) | 291510 Number of splices: GT/AG | 290637 Number of splices: GC/AG | 5410 Number of splices: AT/AC | 727 Number of splices: Non-canonical | 1371 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405968 % of reads mapped to multiple loci | 10.15% Number of reads mapped to too many loci | 291959 % of reads mapped to too many loci | 7.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 401966 401966 401966 N_multimapping 405968 405968 405968 N_noFeature 538175 3116078 605254 N_ambiguous 17929 102 9128 UnstrandedReadsAssigned:2635775 PositiveStrandReadsAssigned:75699 NegativeStrandReadsAssigned:2577497 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423366 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423366-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,813 reads, 3,051,904 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR5423366.ke.tsv 34699 SRR5423366.se.tsv 87100 total ==> SRR5423366.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 315.844 58.8631 Potri.005G024800.1.v4.1 1035 936 27 10.3165 Potri.004G059700.1.v4.1 961 862 2 0.829788 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 64.5718 8.12004 Potri.016G087400.1.v4.1 270 171 11 23.006 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 19.9161 4.25493 Potri.012G127500.1.v4.1 977 878 99 40.326 ==> SRR5423366.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423366 completed mapping pipeline successfully