Starting /dee2/code/volunteer_pipeline.sh SRR5423367 current disk space = 3052127232000 free memory = 1579720844 SRR5423367 SRAfilesize 8eeee9090f827369348e06825a8e6c8d SRR5423367.sra SRR5423367.sra file validated SRR5423367 is single end SRR5423367 is conventional basespace SRR5423367 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423367_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.89625 31.0 30.0 33.0 28.0 34.0 2 31.23675 31.0 31.0 34.0 28.0 34.0 3 31.26875 31.0 31.0 34.0 28.0 34.0 4 31.52925 35.0 30.0 37.0 19.0 37.0 5 33.66975 35.0 33.0 37.0 28.0 37.0 6 34.42225 35.0 35.0 37.0 31.0 37.0 7 34.8015 35.0 35.0 37.0 32.0 37.0 8 35.01375 36.0 35.0 37.0 32.0 37.0 9 36.67275 39.0 35.0 39.0 32.0 39.0 10 36.5855 39.0 35.0 39.0 32.0 39.0 11 36.75675 39.0 35.0 39.0 32.0 39.0 12 36.7485 39.0 37.0 39.0 33.0 39.0 13 36.4355 38.0 35.0 39.0 32.0 39.0 14 37.82025 39.0 37.0 41.0 33.0 41.0 15 37.798 39.0 37.0 41.0 33.0 41.0 16 37.7245 40.0 37.0 41.0 32.0 41.0 17 37.7925 40.0 37.0 41.0 33.0 41.0 18 37.644 39.0 37.0 41.0 32.0 41.0 19 37.632 39.0 37.0 41.0 32.0 41.0 20 37.696 39.0 37.0 41.0 32.0 41.0 21 37.62075 39.0 37.0 41.0 32.0 41.0 22 37.59825 39.0 37.0 41.0 32.0 41.0 23 37.79875 39.0 37.0 41.0 33.0 41.0 24 37.879 40.0 37.0 41.0 32.0 41.0 25 37.86475 40.0 37.0 41.0 32.0 41.0 26 37.827 40.0 37.0 41.0 33.0 41.0 27 37.59525 39.0 37.0 41.0 32.0 41.0 28 37.479 39.0 36.0 41.0 32.0 41.0 29 37.66275 40.0 37.0 41.0 32.0 41.0 30 37.593 40.0 37.0 41.0 32.0 41.0 31 37.709 40.0 37.0 41.0 33.0 41.0 32 37.7635 40.0 37.0 41.0 33.0 41.0 33 37.8305 40.0 37.0 41.0 33.0 41.0 34 37.43975 39.0 36.0 41.0 31.0 41.0 35 37.12525 39.0 36.0 41.0 31.0 41.0 36 37.24575 39.0 36.0 40.0 31.0 41.0 37 37.276 39.0 36.0 41.0 31.0 41.0 38 37.1585 39.0 36.0 40.0 31.0 41.0 39 36.997 39.0 36.0 40.0 31.0 41.0 40 36.986 39.0 36.0 40.0 31.0 41.0 41 36.9045 39.0 36.0 40.0 30.0 41.0 42 36.95475 39.0 35.0 40.0 31.0 41.0 43 37.16175 39.0 36.0 40.0 31.0 41.0 44 36.89525 39.0 35.0 40.0 30.0 41.0 45 36.86325 39.0 35.0 40.0 30.0 41.0 46 36.558 38.0 35.0 40.0 30.0 41.0 47 36.89375 39.0 35.0 40.0 30.0 41.0 48 36.59475 39.0 35.0 40.0 30.0 41.0 49 36.37075 39.0 35.0 40.0 30.0 41.0 50 36.28525 38.0 35.0 40.0 29.0 41.0 51 36.4265 38.0 35.0 40.0 30.0 41.0 52 35.89875 38.0 34.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1316 1 0.0 1316 2 0.0 1316 3 0.0 1316 4 0.0 1316 5 0.0 1316 6 0.0 1316 7 0.0 1316 8 0.0 1316 9 0.0 1316 10 0.0 1316 11 0.0 1316 12 0.0 1316 13 0.0 1316 14 0.0 1316 15 0.0 1316 16 0.0 1316 17 0.0 1316 18 0.0 1316 19 0.0 1316 20 0.0 1316 21 0.0 1316 22 0.0 1316 23 0.0 1316 24 0.0 1316 25 0.0 1316 26 0.0 1316 27 0.0 1316 28 0.0 1316 29 0.0 1316 30 0.0 1316 31 0.0 1316 32 0.0 1316 33 0.0 1316 34 0.0 1316 35 0.0 1316 36 0.0 1316 37 0.0 1316 38 0.0 1316 39 0.0 1316 40 0.0 1316 41 0.0 1316 42 0.0 1316 43 0.0 1316 44 0.0 1316 45 0.0 1316 46 0.0 1316 47 0.0 1316 48 0.0 1316 49 0.0 1316 50 0.0 1316 51 0.0 1316 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 2.0 23 6.0 24 6.0 25 7.0 26 21.0 27 28.0 28 53.0 29 68.0 30 81.0 31 120.0 32 150.0 33 190.0 34 231.0 35 315.0 36 432.0 37 574.0 38 790.0 39 923.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.86843421710855 12.156078039019508 6.528264132066034 44.4472236118059 2 22.650000000000002 15.35 35.375 26.625 3 20.875 17.974999999999998 24.075 37.075 4 26.224999999999998 25.900000000000002 20.575 27.3 5 23.425 31.5 23.45 21.625 6 18.95 33.5 23.150000000000002 24.4 7 14.099999999999998 23.875 41.975 20.05 8 16.75 24.474999999999998 31.3 27.474999999999998 9 16.650000000000002 21.75 34.8 26.8 10 18.5 36.875 25.025 19.6 11 22.8 27.175 22.275 27.750000000000004 12 21.2 25.124999999999996 26.75 26.924999999999997 13 19.7 28.349999999999998 26.400000000000002 25.55 14 20.375 27.35 26.775 25.5 15 20.025000000000002 26.625 28.65 24.7 16 19.85 26.174999999999997 26.474999999999998 27.500000000000004 17 22.15 25.924999999999997 26.75 25.174999999999997 18 20.275000000000002 27.125 26.025 26.575 19 20.724999999999998 27.35 26.424999999999997 25.5 20 20.599999999999998 26.650000000000002 27.1 25.650000000000002 21 20.599999999999998 25.85 26.825 26.724999999999998 22 19.950000000000003 26.974999999999998 26.75 26.325 23 20.8 28.000000000000004 25.724999999999998 25.474999999999998 24 21.075 27.125 25.374999999999996 26.424999999999997 25 20.175 28.050000000000004 25.074999999999996 26.700000000000003 26 20.9 27.35 26.8 24.95 27 21.175 26.674999999999997 25.825 26.325 28 21.9 27.0 26.0 25.1 29 21.125 26.85 27.55 24.474999999999998 30 21.025 25.924999999999997 26.025 27.025 31 21.5 26.724999999999998 26.224999999999998 25.55 32 21.05 26.875 26.625 25.45 33 21.525 26.6 26.0 25.874999999999996 34 21.725 27.05 27.025 24.2 35 21.525 26.174999999999997 26.125 26.174999999999997 36 21.349999999999998 26.224999999999998 25.174999999999997 27.250000000000004 37 20.275000000000002 26.75 25.424999999999997 27.55 38 20.875 27.450000000000003 26.025 25.650000000000002 39 20.849999999999998 26.375 25.424999999999997 27.35 40 21.575 26.3 25.8 26.325 41 21.325 27.05 26.174999999999997 25.45 42 20.75 26.1 27.175 25.974999999999998 43 21.475 27.525 25.25 25.75 44 22.45 26.450000000000003 25.025 26.075 45 21.675 26.724999999999998 25.924999999999997 25.674999999999997 46 21.85 26.900000000000002 26.174999999999997 25.074999999999996 47 22.125 25.4 25.75 26.724999999999998 48 22.0 25.275 25.874999999999996 26.85 49 22.2 27.175 23.925 26.700000000000003 50 21.75 26.6 25.624999999999996 26.025 51 20.724999999999998 25.6 26.525 27.150000000000002 52 23.150000000000002 26.700000000000003 24.425 25.724999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.5 15 2.0 16 3.5 17 5.0 18 5.0 19 5.0 20 7.5 21 10.0 22 11.0 23 12.0 24 15.0 25 18.0 26 24.0 27 30.0 28 36.5 29 43.0 30 61.0 31 79.0 32 91.5 33 104.0 34 114.0 35 124.0 36 141.0 37 158.0 38 200.5 39 238.0 40 233.0 41 253.0 42 273.0 43 289.0 44 305.0 45 288.5 46 272.0 47 285.5 48 299.0 49 299.5 50 300.0 51 289.5 52 279.0 53 282.5 54 286.0 55 242.0 56 198.0 57 193.0 58 188.0 59 169.0 60 150.0 61 134.5 62 119.0 63 106.0 64 80.5 65 68.0 66 48.5 67 29.0 68 23.5 69 18.0 70 15.5 71 13.0 72 16.5 73 20.0 74 18.0 75 16.0 76 9.0 77 2.0 78 2.0 79 2.0 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 96.84791174152876 92.175 2 2.25899658523772 4.3 3 0.5778828473863935 1.6500000000000001 4 0.18387181507748881 0.7000000000000001 5 0.026267402153926978 0.125 6 0.026267402153926978 0.15 7 0.0 0.0 8 0.026267402153926978 0.2 9 0.0 0.0 >10 0.052534804307853955 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 16 0.4 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 12 0.3 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 8 0.2 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 6 0.15 No Hit AAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra Read 200000 spots for SRR5423367.sra Written 200000 spots for SRR5423367.sra SRR ids: ['SRR5423367.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_waj9afhn SRR5423367.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423367 file size 703973 SRR5423367 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423367 SRR5423367_1.fastq Input file: SRR5423367_1.fastq trimmed: SRR5423367-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 03:02:24 2025 >> started Thu Feb 13 03:07:49 2025 >> done (325.492s) 4000000 reads processed; of these: 109 ( 0.00%) short reads filtered out after trimming by size control 64 ( 0.00%) empty reads filtered out after trimming by size control 3999827 (100.00%) reads available; of these: 96742 ( 2.42%) trimmed reads available after processing 3903085 (97.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 6 0.00% 21 0 0.00% 22 1 0.00% 23 3 0.00% 24 4 0.00% 25 6 0.00% 26 10 0.00% 27 10 0.00% 28 11 0.00% 29 20 0.00% 30 14 0.00% 31 22 0.00% 32 42 0.00% 33 30 0.00% 34 41 0.00% 35 55 0.00% 36 63 0.00% 37 82 0.00% 38 83 0.00% 39 94 0.00% 40 120 0.00% 41 169 0.00% 42 191 0.00% 43 319 0.01% 44 368 0.01% 45 558 0.01% 46 798 0.02% 47 1358 0.03% 48 2253 0.06% 49 4837 0.12% 50 12677 0.32% 51 72488 1.81% 52 3903085 97.58% 3999827 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=14.67 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=2.7 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCC Started job on | Feb 13 03:14:03 Started mapping on | Feb 13 03:14:14 Finished on | Feb 13 03:58:36 Mapping speed, Million of reads per hour | 5.41 Number of input reads | 3999827 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3199296 Uniquely mapped reads % | 79.99% Average mapped length | 51.76 Number of splices: Total | 298107 Number of splices: Annotated (sjdb) | 291318 Number of splices: GT/AG | 290827 Number of splices: GC/AG | 5197 Number of splices: AT/AC | 730 Number of splices: Non-canonical | 1353 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409016 % of reads mapped to multiple loci | 10.23% Number of reads mapped to too many loci | 278570 % of reads mapped to too many loci | 6.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 391515 391515 391515 N_multimapping 409016 409016 409016 N_noFeature 537180 3123730 603989 N_ambiguous 17864 123 9007 UnstrandedReadsAssigned:2644252 PositiveStrandReadsAssigned:75443 NegativeStrandReadsAssigned:2586300 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423367 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423367-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,827 reads, 3,045,285 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR5423367.ke.tsv 34699 SRR5423367.se.tsv 87100 total ==> SRR5423367.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 321 60.0428 Potri.005G024800.1.v4.1 1035 936 27 10.3542 Potri.004G059700.1.v4.1 961 862 2 0.832824 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 70.9278 8.95194 Potri.016G087400.1.v4.1 270 171 13 27.2884 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 11.8741 2.54609 Potri.012G127500.1.v4.1 977 878 87 35.5677 ==> SRR5423367.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 36 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423367 completed mapping pipeline successfully