Starting /dee2/code/volunteer_pipeline.sh SRR5423368 current disk space = 3052169773056 free memory = 1580107540 SRR5423368 SRAfilesize 771f7d09fdb9a3ac9a9644ebac29a50d SRR5423368.sra SRR5423368.sra file validated SRR5423368 is single end SRR5423368 is conventional basespace SRR5423368 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.105 31.0 31.0 34.0 28.0 34.0 2 31.60725 31.0 31.0 34.0 30.0 34.0 3 31.854 31.0 31.0 34.0 30.0 34.0 4 32.158 35.0 32.0 37.0 19.0 37.0 5 33.553 35.0 33.0 37.0 28.0 37.0 6 34.5545 35.0 35.0 37.0 31.0 37.0 7 35.08575 36.0 35.0 37.0 32.0 37.0 8 35.294 37.0 35.0 37.0 33.0 37.0 9 37.00825 39.0 37.0 39.0 33.0 39.0 10 36.8485 39.0 37.0 39.0 33.0 39.0 11 37.068 39.0 37.0 39.0 33.0 39.0 12 36.99625 39.0 37.0 39.0 33.0 39.0 13 36.9285 39.0 37.0 39.0 33.0 39.0 14 38.246 40.0 37.0 41.0 33.0 41.0 15 38.22725 40.0 37.0 41.0 33.0 41.0 16 37.941 40.0 37.0 41.0 33.0 41.0 17 38.03425 40.0 37.0 41.0 33.0 41.0 18 38.135 40.0 37.0 41.0 33.0 41.0 19 38.26675 40.0 37.0 41.0 34.0 41.0 20 38.144 40.0 37.0 41.0 33.0 41.0 21 38.148 40.0 37.0 41.0 33.0 41.0 22 38.15075 40.0 37.0 41.0 33.0 41.0 23 38.0575 40.0 37.0 41.0 33.0 41.0 24 37.93375 40.0 37.0 41.0 33.0 41.0 25 38.06225 40.0 37.0 41.0 33.0 41.0 26 37.9035 40.0 37.0 41.0 33.0 41.0 27 37.98325 40.0 37.0 41.0 33.0 41.0 28 37.76575 40.0 37.0 41.0 32.0 41.0 29 37.9345 40.0 37.0 41.0 33.0 41.0 30 37.849 40.0 37.0 41.0 33.0 41.0 31 37.9225 40.0 37.0 41.0 33.0 41.0 32 37.76275 40.0 37.0 41.0 32.0 41.0 33 37.4765 40.0 36.0 41.0 31.0 41.0 34 37.5705 40.0 37.0 41.0 32.0 41.0 35 37.62475 40.0 37.0 41.0 32.0 41.0 36 37.5045 40.0 37.0 41.0 31.0 41.0 37 37.594 40.0 37.0 41.0 32.0 41.0 38 37.616 40.0 37.0 41.0 32.0 41.0 39 37.50925 40.0 37.0 41.0 31.0 41.0 40 37.41525 39.0 37.0 41.0 31.0 41.0 41 36.96625 39.0 36.0 41.0 30.0 41.0 42 36.945 39.0 36.0 40.0 31.0 41.0 43 37.14025 39.0 36.0 41.0 31.0 41.0 44 36.90325 39.0 35.0 41.0 30.0 41.0 45 36.6975 39.0 35.0 40.0 30.0 41.0 46 36.8335 39.0 35.0 40.0 30.0 41.0 47 36.90025 39.0 35.0 40.0 30.0 41.0 48 36.7535 39.0 35.0 40.0 30.0 41.0 49 36.435 39.0 35.0 40.0 30.0 41.0 50 36.5415 39.0 35.0 40.0 30.0 41.0 51 36.738 39.0 35.0 40.0 30.0 41.0 52 35.8975 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2112 1 0.0 2112 2 0.0 2112 3 0.0 2112 4 0.0 2112 5 0.0 2112 6 0.0 2112 7 0.0 2112 8 0.0 2112 9 0.0 2112 10 0.0 2112 11 0.0 2112 12 0.0 2112 13 0.0 2112 14 0.0 2112 15 0.0 2112 16 0.0 2112 17 0.0 2112 18 0.0 2112 19 0.0 2112 20 0.0 2112 21 0.0 2112 22 0.0 2112 23 0.0 2112 24 0.0 2112 25 0.0 2112 26 0.0 2112 27 0.0 2112 28 0.0 2112 29 0.0 2112 30 0.0 2112 31 0.0 2112 32 0.0 2112 33 0.0 2112 34 0.0 2112 35 0.0 2112 36 0.0 2112 37 0.0 2112 38 0.0 2112 39 0.0 2112 40 0.0 2112 41 0.0 2112 42 0.0 2112 43 0.0 2112 44 0.0 2112 45 0.0 2112 46 0.0 2112 47 0.0 2112 48 0.0 2112 49 0.0 2112 50 0.0 2112 51 0.0 2112 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 2.0 22 2.0 23 5.0 24 9.0 25 9.0 26 16.0 27 29.0 28 35.0 29 60.0 30 78.0 31 113.0 32 139.0 33 187.0 34 216.0 35 290.0 36 363.0 37 524.0 38 729.0 39 1188.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.88298672012027 12.177399148083188 6.915560010022551 44.02405412177399 2 23.674999999999997 14.975 34.55 26.8 3 20.025000000000002 19.275000000000002 24.05 36.65 4 23.95 26.150000000000002 22.375 27.525 5 23.9 31.6 24.5 20.0 6 19.05 33.625 25.15 22.175 7 14.424999999999999 23.775 41.9 19.900000000000002 8 17.5 22.825 31.474999999999998 28.199999999999996 9 17.224999999999998 21.95 35.199999999999996 25.624999999999996 10 18.224999999999998 38.05 24.099999999999998 19.625 11 22.35 28.275 21.9 27.474999999999998 12 20.95 25.4 26.8 26.85 13 18.775 27.825 28.749999999999996 24.65 14 20.65 28.15 27.1 24.099999999999998 15 20.674999999999997 27.025 27.025 25.275 16 19.675 25.275 27.875 27.175 17 21.325 26.6 26.625 25.45 18 20.200000000000003 27.35 26.25 26.200000000000003 19 20.125 26.875 26.325 26.674999999999997 20 20.8 27.1 25.95 26.150000000000002 21 21.475 25.775 26.125 26.625 22 19.504876219054765 27.506876719179797 26.281570392598148 26.70667666916729 23 20.75 27.224999999999998 26.0 26.025 24 21.9 24.875 26.125 27.1 25 20.75 26.125 26.5 26.625 26 21.175 26.55 26.674999999999997 25.6 27 20.325 27.975 27.075 24.625 28 20.65 27.3 26.775 25.275 29 20.825 27.775 27.575 23.825 30 19.85 26.3 27.85 26.0 31 21.2 27.200000000000003 25.55 26.05 32 21.725 26.650000000000002 25.900000000000002 25.724999999999998 33 21.25 26.974999999999998 25.174999999999997 26.6 34 20.724999999999998 26.400000000000002 27.625 25.25 35 21.65 25.45 26.1 26.8 36 20.575 27.725 25.424999999999997 26.275 37 20.1 28.000000000000004 26.450000000000003 25.45 38 21.4 26.375 24.425 27.800000000000004 39 20.724999999999998 25.525 26.674999999999997 27.075 40 21.7 26.974999999999998 26.650000000000002 24.675 41 22.15 26.75 25.1 26.0 42 19.75 27.224999999999998 27.325 25.7 43 21.7 27.925 24.975 25.4 44 22.125 26.025 25.2 26.650000000000002 45 22.425 25.6 26.6 25.374999999999996 46 21.575 25.2 25.924999999999997 27.3 47 22.225 25.35 25.275 27.150000000000002 48 21.15 27.650000000000002 25.0 26.200000000000003 49 20.530132533133283 26.556639159789945 25.93148287071768 26.981745436359088 50 20.724999999999998 28.375 24.2 26.700000000000003 51 21.224999999999998 26.25 26.674999999999997 25.85 52 22.15 26.650000000000002 25.55 25.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 2.5 17 4.0 18 6.0 19 8.0 20 9.0 21 10.0 22 7.5 23 5.0 24 14.5 25 24.0 26 34.0 27 44.0 28 49.0 29 54.0 30 61.5 31 69.0 32 88.5 33 108.0 34 121.0 35 134.0 36 162.0 37 190.0 38 195.5 39 222.5 40 244.0 41 254.5 42 265.0 43 282.0 44 299.0 45 295.0 46 291.0 47 307.5 48 324.0 49 296.5 50 269.0 51 277.0 52 285.0 53 278.0 54 271.0 55 239.5 56 208.0 57 196.0 58 184.0 59 177.0 60 170.0 61 146.5 62 123.0 63 94.5 64 61.0 65 56.0 66 43.0 67 30.0 68 19.0 69 8.0 70 11.0 71 14.0 72 16.5 73 19.0 74 13.5 75 8.0 76 7.5 77 7.0 78 6.0 79 5.0 80 3.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.025 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.025 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.27463312368972 92.80000000000001 2 1.9916142557651992 3.8 3 0.3144654088050315 0.8999999999999999 4 0.15723270440251574 0.6 5 0.052410901467505246 0.25 6 0.07861635220125787 0.44999999999999996 7 0.026205450733752623 0.17500000000000002 8 0.026205450733752623 0.2 9 0.026205450733752623 0.22499999999999998 >10 0.052410901467505246 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 13 0.325 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 11 0.27499999999999997 No Hit GCCACTTACAATACCCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACC 9 0.22499999999999998 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 8 0.2 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 7 0.17500000000000002 No Hit GGTGCATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGT 6 0.15 No Hit CCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACC 6 0.15 No Hit CCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGG 6 0.15 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra Read 200000 spots for SRR5423368.sra Written 200000 spots for SRR5423368.sra SRR ids: ['SRR5423368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0hk5oe76 SRR5423368.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423368 file size 703971 SRR5423368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423368 SRR5423368_1.fastq Input file: SRR5423368_1.fastq trimmed: SRR5423368-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 02:53:57 2025 >> started Thu Feb 13 03:05:06 2025 >> done (668.452s) 4000000 reads processed; of these: 108 ( 0.00%) short reads filtered out after trimming by size control 77 ( 0.00%) empty reads filtered out after trimming by size control 3999815 (100.00%) reads available; of these: 98923 ( 2.47%) trimmed reads available after processing 3900892 (97.53%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 4 0.00% 25 3 0.00% 26 9 0.00% 27 9 0.00% 28 19 0.00% 29 14 0.00% 30 23 0.00% 31 33 0.00% 32 56 0.00% 33 65 0.00% 34 52 0.00% 35 34 0.00% 36 77 0.00% 37 82 0.00% 38 87 0.00% 39 100 0.00% 40 131 0.00% 41 209 0.01% 42 231 0.01% 43 284 0.01% 44 382 0.01% 45 568 0.01% 46 802 0.02% 47 1422 0.04% 48 2513 0.06% 49 4863 0.12% 50 13263 0.33% 51 73574 1.84% 52 3900892 97.53% 3999815 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=10.20 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=5.4 sequence=AAAAAAAAAATACGTATTTTTTTATAGGATTAGATTAAACAAATCAAATATAGGATTAAACAAAAGGATTCGCAAATAAAAGTGCTAATGCTACAACCAGTCCATAAATTGTTAAAGCTTCCATAAAAGCCAGACTAAGCAATAAAGTACCTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTGGCCCGCAGCAGTACCTTGACCAACCCCAGGTCCAATAGAAGCAAGCCCAAC Started job on | Feb 13 03:12:15 Started mapping on | Feb 13 03:12:32 Finished on | Feb 13 03:59:39 Mapping speed, Million of reads per hour | 5.09 Number of input reads | 3999815 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3200359 Uniquely mapped reads % | 80.01% Average mapped length | 51.76 Number of splices: Total | 298345 Number of splices: Annotated (sjdb) | 291472 Number of splices: GT/AG | 291176 Number of splices: GC/AG | 5096 Number of splices: AT/AC | 700 Number of splices: Non-canonical | 1373 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408010 % of reads mapped to multiple loci | 10.20% Number of reads mapped to too many loci | 277579 % of reads mapped to too many loci | 6.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 391446 391446 391446 N_multimapping 408010 408010 408010 N_noFeature 538055 3125863 603776 N_ambiguous 17929 137 9036 UnstrandedReadsAssigned:2644375 PositiveStrandReadsAssigned:74359 NegativeStrandReadsAssigned:2587547 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423368 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423368-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,815 reads, 3,034,020 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR5423368.ke.tsv 34699 SRR5423368.se.tsv 87100 total ==> SRR5423368.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 352 66.143 Potri.005G024800.1.v4.1 1035 936 37.0851 14.287 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 76.6275 9.71564 Potri.016G087400.1.v4.1 270 171 17 35.8483 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15.9497 3.43568 Potri.012G127500.1.v4.1 977 878 97 39.8376 ==> SRR5423368.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR5423368 completed mapping pipeline successfully