Starting /dee2/code/volunteer_pipeline.sh SRR5423369 current disk space = 3052001808384 free memory = 1577119104 SRR5423369 SRAfilesize a52b49ab8794e13a33778ce8780fbcd5 SRR5423369.sra SRR5423369.sra file validated SRR5423369 is single end SRR5423369 is conventional basespace SRR5423369 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23175 34.0 31.0 34.0 30.0 34.0 2 32.2905 34.0 31.0 34.0 30.0 34.0 3 32.334 34.0 31.0 34.0 30.0 34.0 4 35.8375 37.0 35.0 37.0 33.0 37.0 5 35.78825 37.0 35.0 37.0 33.0 37.0 6 35.8065 37.0 35.0 37.0 35.0 37.0 7 35.781 37.0 35.0 37.0 35.0 37.0 8 35.7605 37.0 35.0 37.0 35.0 37.0 9 37.41725 39.0 37.0 39.0 34.0 39.0 10 37.295 39.0 37.0 39.0 34.0 39.0 11 37.2025 39.0 37.0 39.0 33.0 39.0 12 37.28375 39.0 37.0 39.0 34.0 39.0 13 37.2155 39.0 37.0 39.0 33.0 39.0 14 38.6175 40.0 38.0 41.0 34.0 41.0 15 38.621 40.0 38.0 41.0 34.0 41.0 16 38.58 40.0 38.0 41.0 34.0 41.0 17 38.58975 40.0 38.0 41.0 34.0 41.0 18 38.609 40.0 38.0 41.0 34.0 41.0 19 38.55925 40.0 38.0 41.0 34.0 41.0 20 38.59075 40.0 38.0 41.0 34.0 41.0 21 38.6055 40.0 38.0 41.0 34.0 41.0 22 38.63925 40.0 38.0 41.0 34.0 41.0 23 38.53175 40.0 38.0 41.0 34.0 41.0 24 38.50575 40.0 38.0 41.0 34.0 41.0 25 38.384 40.0 38.0 41.0 34.0 41.0 26 38.45475 40.0 38.0 41.0 34.0 41.0 27 38.14 40.0 38.0 41.0 33.0 41.0 28 38.25925 40.0 38.0 41.0 33.0 41.0 29 38.113 40.0 38.0 41.0 33.0 41.0 30 38.17275 40.0 38.0 41.0 33.0 41.0 31 38.119 40.0 38.0 41.0 33.0 41.0 32 38.1255 40.0 38.0 41.0 33.0 41.0 33 38.00225 40.0 38.0 41.0 33.0 41.0 34 37.712 40.0 37.0 41.0 32.0 41.0 35 37.796 40.0 37.0 41.0 32.0 41.0 36 37.76 40.0 37.0 41.0 32.0 41.0 37 37.7305 40.0 37.0 41.0 32.0 41.0 38 37.5415 40.0 37.0 41.0 31.0 41.0 39 37.61925 40.0 37.0 41.0 32.0 41.0 40 37.4705 40.0 37.0 41.0 31.0 41.0 41 37.48625 40.0 37.0 41.0 31.0 41.0 42 37.34575 40.0 36.0 41.0 31.0 41.0 43 37.21075 40.0 36.0 41.0 31.0 41.0 44 37.20975 40.0 36.0 41.0 31.0 41.0 45 36.982 39.0 36.0 41.0 30.0 41.0 46 37.026 40.0 36.0 41.0 30.0 41.0 47 37.056 40.0 36.0 41.0 31.0 41.0 48 37.03575 39.0 36.0 41.0 31.0 41.0 49 37.0795 39.0 36.0 41.0 31.0 41.0 50 36.7495 39.0 35.0 41.0 30.0 41.0 51 36.72875 39.0 35.0 41.0 30.0 41.0 52 35.585 38.0 34.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2209 1 0.0 2209 2 0.0 2209 3 0.0 2209 4 0.0 2209 5 0.0 2209 6 0.0 2209 7 0.0 2209 8 0.0 2209 9 0.0 2209 10 0.0 2209 11 0.0 2209 12 0.0 2209 13 0.0 2209 14 0.0 2209 15 0.0 2209 16 0.0 2209 17 0.0 2209 18 0.0 2209 19 0.0 2209 20 0.0 2209 21 0.0 2209 22 0.0 2209 23 0.0 2209 24 0.0 2209 25 0.0 2209 26 0.0 2209 27 0.0 2209 28 0.0 2209 29 0.0 2209 30 0.0 2209 31 0.0 2209 32 0.0 2209 33 0.0 2209 34 0.0 2209 35 0.0 2209 36 0.0 2209 37 0.0 2209 38 0.0 2209 39 0.0 2209 40 0.0 2209 41 0.0 2209 42 0.0 2209 43 0.0 2209 44 0.0 2209 45 0.0 2209 46 0.0 2209 47 0.0 2209 48 0.0 2209 49 0.0 2209 50 0.0 2209 51 0.0 2209 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 4.0 22 5.0 23 5.0 24 11.0 25 15.0 26 16.0 27 25.0 28 44.0 29 41.0 30 67.0 31 78.0 32 101.0 33 120.0 34 179.0 35 240.0 36 279.0 37 420.0 38 727.0 39 1612.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.79599499374218 12.415519399249062 6.0826032540675845 44.70588235294118 2 23.974999999999998 14.875 33.85 27.3 3 21.275 18.5 22.175 38.05 4 25.724999999999998 26.075 20.9 27.3 5 24.975 29.825000000000003 24.224999999999998 20.974999999999998 6 19.8 33.375 23.925 22.900000000000002 7 14.825 22.45 43.05 19.675 8 17.525 21.525 31.45 29.5 9 17.95 22.25 33.875 25.924999999999997 10 18.8 38.05 23.150000000000002 20.0 11 22.3 27.250000000000004 21.375 29.075 12 21.6 23.724999999999998 27.775 26.900000000000002 13 19.950000000000003 26.700000000000003 28.725 24.625 14 20.325 26.6 26.775 26.3 15 20.575 27.275 27.425 24.725 16 20.125 25.95 27.725 26.200000000000003 17 20.474999999999998 25.55 27.474999999999998 26.5 18 20.825 28.000000000000004 26.0 25.174999999999997 19 21.625 26.85 25.25 26.275 20 20.3 27.1 27.975 24.625 21 20.255063765941486 26.156539134783696 27.881970492623154 25.70642660665166 22 21.475 26.700000000000003 26.125 25.7 23 21.85 27.200000000000003 26.150000000000002 24.8 24 20.75 27.6 25.85 25.8 25 22.8 26.974999999999998 24.775 25.45 26 20.8 26.450000000000003 25.6 27.150000000000002 27 21.025 26.875 25.7 26.400000000000002 28 22.3 25.174999999999997 25.575 26.950000000000003 29 21.925 25.624999999999996 25.5 26.950000000000003 30 20.575 25.624999999999996 27.250000000000004 26.55 31 21.224999999999998 27.525 26.325 24.925 32 21.875 25.324999999999996 26.1 26.700000000000003 33 19.650000000000002 26.575 25.874999999999996 27.900000000000002 34 20.65 26.650000000000002 27.0 25.7 35 22.25 25.85 25.525 26.375 36 20.8 27.3 25.074999999999996 26.825 37 21.525 25.7 25.7 27.075 38 21.65 26.525 25.900000000000002 25.924999999999997 39 22.025 24.9 26.325 26.75 40 21.175 25.575 25.75 27.500000000000004 41 21.9 27.450000000000003 25.474999999999998 25.174999999999997 42 21.075 25.75 25.874999999999996 27.3 43 21.775 26.075 26.05 26.1 44 21.5 26.05 25.924999999999997 26.525 45 21.5 26.224999999999998 25.5 26.775 46 22.175 25.0 25.624999999999996 27.200000000000003 47 22.85 24.45 25.15 27.55 48 21.360680340170084 26.538269134567283 25.6128064032016 26.488244122061033 49 22.0 26.875 25.7 25.424999999999997 50 20.925 26.924999999999997 24.8 27.35 51 21.48037009252313 26.831707926981746 24.8062015503876 26.881720430107524 52 22.375 27.200000000000003 24.75 25.674999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.5 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 2.0 18 2.5 19 3.0 20 6.5 21 10.0 22 10.0 23 10.0 24 12.5 25 15.0 26 24.0 27 33.0 28 36.5 29 40.0 30 50.5 31 61.0 32 80.0 33 99.0 34 115.0 35 131.0 36 148.5 37 166.0 38 197.0 39 233.0 40 238.0 41 248.5 42 259.0 43 264.5 44 270.0 45 284.0 46 298.0 47 282.0 48 266.0 49 272.5 50 279.0 51 294.0 52 309.0 53 299.5 54 290.0 55 258.5 56 227.0 57 204.0 58 181.0 59 171.0 60 161.0 61 150.0 62 139.0 63 112.5 64 76.5 65 67.0 66 55.5 67 44.0 68 30.0 69 16.0 70 19.5 71 23.0 72 20.5 73 18.0 74 17.0 75 16.0 76 9.0 77 2.0 78 3.0 79 4.0 80 3.5 81 3.0 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.05 49 0.0 50 0.0 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 96.90613529103304 92.4 2 2.3072889355007864 4.3999999999999995 3 0.4981646565285789 1.425 4 0.07865757734661773 0.3 5 0.1048767697954903 0.5 6 0.026219192448872573 0.15 7 0.026219192448872573 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05243838489774515 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 16 0.4 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 10 0.25 No Hit CCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGA 7 0.17500000000000002 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 6 0.15 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 5 0.125 No Hit CGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGCGGCTCTTTCACCG 5 0.125 No Hit GTTCTGTTAGCCCACAGTGTTGGTGGACTTGAGTGAATAACTGTAGCAATTG 5 0.125 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra Read 200000 spots for SRR5423369.sra Written 200000 spots for SRR5423369.sra SRR ids: ['SRR5423369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iyc2dmjx SRR5423369.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423369 file size 703979 SRR5423369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423369 SRR5423369_1.fastq Input file: SRR5423369_1.fastq trimmed: SRR5423369-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 03:33:02 2025 >> started Thu Feb 13 03:38:34 2025 >> done (331.205s) 4000000 reads processed; of these: 119 ( 0.00%) short reads filtered out after trimming by size control 97 ( 0.00%) empty reads filtered out after trimming by size control 3999784 (99.99%) reads available; of these: 81385 ( 2.03%) trimmed reads available after processing 3918399 (97.97%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 4 0.00% 26 4 0.00% 27 11 0.00% 28 13 0.00% 29 14 0.00% 30 14 0.00% 31 25 0.00% 32 27 0.00% 33 34 0.00% 34 30 0.00% 35 40 0.00% 36 49 0.00% 37 48 0.00% 38 78 0.00% 39 78 0.00% 40 115 0.00% 41 117 0.00% 42 132 0.00% 43 198 0.00% 44 296 0.01% 45 408 0.01% 46 691 0.02% 47 1030 0.03% 48 1764 0.04% 49 3556 0.09% 50 10498 0.26% 51 62101 1.55% 52 3918399 97.97% 3999784 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=0.21 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=9.30 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=3.0 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCCCC Started job on | Feb 13 03:42:47 Started mapping on | Feb 13 03:42:59 Finished on | Feb 13 04:06:05 Mapping speed, Million of reads per hour | 10.39 Number of input reads | 3999784 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3198195 Uniquely mapped reads % | 79.96% Average mapped length | 51.77 Number of splices: Total | 297478 Number of splices: Annotated (sjdb) | 290732 Number of splices: GT/AG | 290317 Number of splices: GC/AG | 5107 Number of splices: AT/AC | 716 Number of splices: Non-canonical | 1338 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408105 % of reads mapped to multiple loci | 10.20% Number of reads mapped to too many loci | 281424 % of reads mapped to too many loci | 7.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 393484 393484 393484 N_multimapping 408105 408105 408105 N_noFeature 538706 3123756 604431 N_ambiguous 17817 132 8997 UnstrandedReadsAssigned:2641672 PositiveStrandReadsAssigned:74307 NegativeStrandReadsAssigned:2584767 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423369 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423369-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,784 reads, 3,026,828 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR5423369.ke.tsv 34699 SRR5423369.se.tsv 87100 total ==> SRR5423369.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 313 58.9523 Potri.005G024800.1.v4.1 1035 936 29 11.1983 Potri.004G059700.1.v4.1 961 862 2 0.838599 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 64.9166 8.25007 Potri.016G087400.1.v4.1 270 171 14 29.5913 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 12 2.59094 Potri.012G127500.1.v4.1 977 878 123 50.634 ==> SRR5423369.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 33 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423369 completed mapping pipeline successfully