Starting /dee2/code/volunteer_pipeline.sh SRR5423370 current disk space = 3052004630528 free memory = 1580695312 SRR5423370 SRAfilesize 2ce1e1e209dbaf845ba1ec576042b610 SRR5423370.sra SRR5423370.sra file validated SRR5423370 is single end SRR5423370 is conventional basespace SRR5423370 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423370_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39475 34.0 31.0 34.0 30.0 34.0 2 32.5295 34.0 31.0 34.0 31.0 34.0 3 32.612 34.0 31.0 34.0 31.0 34.0 4 36.08525 37.0 35.0 37.0 35.0 37.0 5 36.06 37.0 35.0 37.0 35.0 37.0 6 36.08425 37.0 35.0 37.0 35.0 37.0 7 36.07525 37.0 35.0 37.0 35.0 37.0 8 36.0645 37.0 35.0 37.0 35.0 37.0 9 37.77 39.0 38.0 39.0 35.0 39.0 10 37.6965 39.0 37.0 39.0 35.0 39.0 11 37.808 39.0 38.0 39.0 35.0 39.0 12 37.6745 39.0 37.0 39.0 35.0 39.0 13 37.59925 39.0 37.0 39.0 35.0 39.0 14 39.0825 40.0 39.0 41.0 36.0 41.0 15 38.93025 40.0 38.0 41.0 36.0 41.0 16 39.023 40.0 38.0 41.0 36.0 41.0 17 38.954 40.0 38.0 41.0 36.0 41.0 18 38.94075 40.0 38.0 41.0 36.0 41.0 19 38.847 40.0 39.0 41.0 35.0 41.0 20 38.9665 40.0 39.0 41.0 35.0 41.0 21 38.878 40.0 38.0 41.0 35.0 41.0 22 38.96025 40.0 39.0 41.0 35.0 41.0 23 38.8815 40.0 38.0 41.0 35.0 41.0 24 38.889 40.0 38.0 41.0 34.0 41.0 25 38.85975 40.0 38.0 41.0 35.0 41.0 26 38.826 40.0 39.0 41.0 35.0 41.0 27 38.643 40.0 38.0 41.0 34.0 41.0 28 38.60925 40.0 38.0 41.0 34.0 41.0 29 38.64625 40.0 38.0 41.0 34.0 41.0 30 38.69925 40.0 38.0 41.0 35.0 41.0 31 38.59975 40.0 38.0 41.0 34.0 41.0 32 38.5095 40.0 38.0 41.0 34.0 41.0 33 38.46725 40.0 38.0 41.0 34.0 41.0 34 38.573 40.0 38.0 41.0 34.0 41.0 35 38.396 40.0 38.0 41.0 34.0 41.0 36 38.4605 40.0 38.0 41.0 34.0 41.0 37 38.2345 40.0 38.0 41.0 33.0 41.0 38 38.26975 40.0 38.0 41.0 33.0 41.0 39 38.18675 40.0 38.0 41.0 33.0 41.0 40 38.0975 40.0 38.0 41.0 33.0 41.0 41 38.04875 40.0 38.0 41.0 33.0 41.0 42 37.817 40.0 37.0 41.0 33.0 41.0 43 37.8465 40.0 37.0 41.0 33.0 41.0 44 37.804 40.0 37.0 41.0 33.0 41.0 45 37.7325 40.0 37.0 41.0 33.0 41.0 46 37.59425 40.0 37.0 41.0 32.0 41.0 47 37.574 40.0 37.0 41.0 32.0 41.0 48 37.46325 40.0 37.0 41.0 32.0 41.0 49 37.1935 40.0 36.0 41.0 31.0 41.0 50 37.27425 40.0 36.0 41.0 31.0 41.0 51 37.22675 40.0 36.0 41.0 31.0 41.0 52 35.838 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2305 1 0.0 2305 2 0.0 2305 3 0.0 2305 4 0.0 2305 5 0.0 2305 6 0.0 2305 7 0.0 2305 8 0.0 2305 9 0.0 2305 10 0.0 2305 11 0.0 2305 12 0.0 2305 13 0.0 2305 14 0.0 2305 15 0.0 2305 16 0.0 2305 17 0.0 2305 18 0.0 2305 19 0.0 2305 20 0.0 2305 21 0.0 2305 22 0.0 2305 23 0.0 2305 24 0.0 2305 25 0.0 2305 26 0.0 2305 27 0.0 2305 28 0.0 2305 29 0.0 2305 30 0.0 2305 31 0.0 2305 32 0.0 2305 33 0.0 2305 34 0.0 2305 35 0.0 2305 36 0.0 2305 37 0.0 2305 38 0.0 2305 39 0.0 2305 40 0.0 2305 41 0.0 2305 42 0.0 2305 43 0.0 2305 44 0.0 2305 45 0.0 2305 46 0.0 2305 47 0.0 2305 48 0.0 2305 49 0.0 2305 50 0.0 2305 51 0.0 2305 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 3.0 22 7.0 23 3.0 24 8.0 25 13.0 26 12.0 27 23.0 28 18.0 29 42.0 30 53.0 31 48.0 32 87.0 33 98.0 34 136.0 35 188.0 36 235.0 37 409.0 38 718.0 39 1891.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.766090658652644 12.121212121212121 6.135737540696218 43.97695967943902 2 23.125 14.000000000000002 34.8 28.075 3 20.775 16.175 24.625 38.425 4 24.474999999999998 26.150000000000002 21.95 27.425 5 23.95 30.025000000000002 24.45 21.575 6 20.4 33.525 22.725 23.35 7 15.049999999999999 24.325 41.125 19.5 8 18.525 22.85 31.125000000000004 27.500000000000004 9 17.925 21.6 34.0 26.474999999999998 10 18.175 37.875 24.275 19.675 11 23.799999999999997 26.974999999999998 21.65 27.575 12 22.575 24.775 26.05 26.6 13 20.625 27.150000000000002 27.0 25.224999999999998 14 20.125 26.950000000000003 28.875 24.05 15 21.175 27.0 27.075 24.75 16 19.775000000000002 26.875 25.900000000000002 27.450000000000003 17 21.55 26.325 26.150000000000002 25.974999999999998 18 21.325 26.474999999999998 26.275 25.924999999999997 19 20.625 26.424999999999997 27.725 25.224999999999998 20 20.599999999999998 26.400000000000002 26.700000000000003 26.3 21 19.725 28.15 26.3 25.825 22 21.224999999999998 26.1 27.1 25.575 23 20.8 25.35 26.150000000000002 27.700000000000003 24 22.0 25.575 27.400000000000002 25.025 25 22.2 28.025 24.45 25.324999999999996 26 21.875 26.6 26.924999999999997 24.6 27 22.3 25.95 26.375 25.374999999999996 28 21.4 26.700000000000003 26.35 25.55 29 21.625 25.825 27.05 25.5 30 21.05 26.525 25.650000000000002 26.775 31 21.275 28.175 24.825 25.724999999999998 32 21.25 27.725 25.85 25.174999999999997 33 20.375 26.974999999999998 25.95 26.700000000000003 34 21.075 26.424999999999997 25.95 26.55 35 21.4 25.85 25.3 27.450000000000003 36 21.9 26.200000000000003 24.15 27.750000000000004 37 20.3 26.450000000000003 26.775 26.474999999999998 38 21.3 26.55 25.900000000000002 26.25 39 20.674999999999997 25.900000000000002 25.724999999999998 27.700000000000003 40 20.75 26.825 26.625 25.8 41 22.125 26.700000000000003 26.150000000000002 25.025 42 21.5 25.474999999999998 26.200000000000003 26.825 43 22.25 26.3 25.4 26.05 44 21.224999999999998 27.175 25.0 26.6 45 22.925 24.725 24.9 27.450000000000003 46 21.875 25.25 26.125 26.75 47 21.675 27.400000000000002 25.8 25.124999999999996 48 22.1 26.200000000000003 24.825 26.875 49 21.65 26.400000000000002 25.1 26.85 50 20.424999999999997 27.900000000000002 24.8 26.875 51 21.099999999999998 25.35 26.224999999999998 27.325 52 22.275 26.724999999999998 25.900000000000002 25.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 2.5 15 5.0 16 3.5 17 2.0 18 4.5 19 7.0 20 10.5 21 14.0 22 13.0 23 12.0 24 15.5 25 19.0 26 26.5 27 34.0 28 35.5 29 37.0 30 56.0 31 75.0 32 89.5 33 104.0 34 116.0 35 128.0 36 144.0 37 160.0 38 177.5 39 209.5 40 224.0 41 247.5 42 271.0 43 285.0 44 299.0 45 306.5 46 314.0 47 294.0 48 274.0 49 273.5 50 273.0 51 269.5 52 266.0 53 281.0 54 296.0 55 260.5 56 225.0 57 214.5 58 204.0 59 174.0 60 144.0 61 135.0 62 126.0 63 109.5 64 89.5 65 86.0 66 56.0 67 26.0 68 21.5 69 17.0 70 18.0 71 19.0 72 19.5 73 20.0 74 15.5 75 11.0 76 11.5 77 12.0 78 8.0 79 4.0 80 2.0 81 0.0 82 0.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.75376088677751 91.64999999999999 2 2.164159408814991 4.1000000000000005 3 0.6070203219846925 1.725 4 0.26392187912377935 1.0 5 0.052784375824755876 0.25 6 0.0791765637371338 0.44999999999999996 7 0.026392187912377938 0.17500000000000002 8 0.0 0.0 9 0.026392187912377938 0.22499999999999998 >10 0.026392187912377938 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 17 0.42500000000000004 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 9 0.22499999999999998 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 6 0.15 No Hit GTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCA 6 0.15 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 6 0.15 No Hit ATCGTCTCTGAGGAGCTCATGTCAGGGTACATCTTGCATCCTCCACAGCCGC 5 0.125 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra Read 200000 spots for SRR5423370.sra Written 200000 spots for SRR5423370.sra SRR ids: ['SRR5423370.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_okt2n4i8 SRR5423370.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423370 file size 703928 SRR5423370 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423370 SRR5423370_1.fastq Input file: SRR5423370_1.fastq trimmed: SRR5423370-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 03:30:46 2025 >> started Thu Feb 13 03:37:40 2025 >> done (413.573s) 4000000 reads processed; of these: 105 ( 0.00%) short reads filtered out after trimming by size control 84 ( 0.00%) empty reads filtered out after trimming by size control 3999811 (100.00%) reads available; of these: 66415 ( 1.66%) trimmed reads available after processing 3933396 (98.34%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 5 0.00% 27 3 0.00% 28 3 0.00% 29 1 0.00% 30 4 0.00% 31 12 0.00% 32 18 0.00% 33 26 0.00% 34 16 0.00% 35 20 0.00% 36 37 0.00% 37 32 0.00% 38 37 0.00% 39 41 0.00% 40 56 0.00% 41 71 0.00% 42 96 0.00% 43 116 0.00% 44 199 0.00% 45 247 0.01% 46 453 0.01% 47 635 0.02% 48 1171 0.03% 49 2573 0.06% 50 7851 0.20% 51 52675 1.32% 52 3933396 98.34% 3999811 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=8.93 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.0 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCCCCGTC Started job on | Feb 13 03:45:44 Started mapping on | Feb 13 03:46:16 Finished on | Feb 13 04:25:42 Mapping speed, Million of reads per hour | 6.09 Number of input reads | 3999811 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3194405 Uniquely mapped reads % | 79.86% Average mapped length | 51.78 Number of splices: Total | 297569 Number of splices: Annotated (sjdb) | 290945 Number of splices: GT/AG | 290138 Number of splices: GC/AG | 5345 Number of splices: AT/AC | 734 Number of splices: Non-canonical | 1352 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406690 % of reads mapped to multiple loci | 10.17% Number of reads mapped to too many loci | 288712 % of reads mapped to too many loci | 7.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 398716 398716 398716 N_multimapping 406690 406690 406690 N_noFeature 538929 3120028 604708 N_ambiguous 17714 109 9032 UnstrandedReadsAssigned:2637762 PositiveStrandReadsAssigned:74268 NegativeStrandReadsAssigned:2580665 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423370 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423370-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,811 reads, 3,046,172 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR5423370.ke.tsv 34699 SRR5423370.se.tsv 87100 total ==> SRR5423370.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 297 55.5113 Potri.005G024800.1.v4.1 1035 936 35 13.412 Potri.004G059700.1.v4.1 961 862 1 0.416095 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 70.3235 8.86892 Potri.016G087400.1.v4.1 270 171 13 27.2676 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 12.938 2.77213 Potri.012G127500.1.v4.1 977 878 86 35.1321 ==> SRR5423370.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 31 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423370 completed mapping pipeline successfully