Starting /dee2/code/volunteer_pipeline.sh SRR5423371 current disk space = 3052098904064 free memory = 1578229160 SRR5423371 SRAfilesize de52223236a22c572b8f5869bbcbae76 SRR5423371.sra SRR5423371.sra file validated SRR5423371 is single end SRR5423371 is conventional basespace SRR5423371 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56475 31.0 31.0 34.0 30.0 34.0 2 31.32125 31.0 31.0 34.0 27.0 34.0 3 31.474 31.0 31.0 34.0 28.0 34.0 4 35.2595 37.0 35.0 37.0 32.0 37.0 5 35.2115 37.0 35.0 37.0 32.0 37.0 6 35.24175 37.0 35.0 37.0 32.0 37.0 7 35.289 37.0 35.0 37.0 33.0 37.0 8 35.2205 37.0 35.0 37.0 32.0 37.0 9 36.667 39.0 35.0 39.0 32.0 39.0 10 36.57 39.0 35.0 39.0 32.0 39.0 11 36.73875 39.0 35.0 39.0 32.0 39.0 12 36.5625 39.0 35.0 39.0 32.0 39.0 13 36.48625 38.0 35.0 39.0 32.0 39.0 14 37.42975 39.0 36.0 41.0 32.0 41.0 15 37.6865 39.0 37.0 41.0 32.0 41.0 16 37.3745 39.0 36.0 41.0 31.0 41.0 17 37.65175 39.0 37.0 41.0 32.0 41.0 18 37.67625 39.0 37.0 41.0 32.0 41.0 19 37.8855 40.0 37.0 41.0 33.0 41.0 20 37.88325 40.0 37.0 41.0 32.0 41.0 21 37.76275 40.0 37.0 41.0 32.0 41.0 22 37.871 40.0 37.0 41.0 33.0 41.0 23 37.7865 39.0 37.0 41.0 32.0 41.0 24 37.60975 39.0 37.0 41.0 32.0 41.0 25 37.59275 39.0 37.0 41.0 32.0 41.0 26 37.14975 39.0 36.0 41.0 31.0 41.0 27 37.3365 39.0 36.0 41.0 31.0 41.0 28 37.25175 39.0 36.0 41.0 31.0 41.0 29 37.10975 39.0 36.0 41.0 30.0 41.0 30 37.349 39.0 36.0 41.0 31.0 41.0 31 37.223 39.0 36.0 41.0 31.0 41.0 32 37.20075 39.0 36.0 41.0 31.0 41.0 33 37.3795 39.0 36.0 41.0 31.0 41.0 34 37.083 39.0 36.0 41.0 30.0 41.0 35 37.27625 39.0 36.0 41.0 31.0 41.0 36 37.391 39.0 36.0 41.0 31.0 41.0 37 37.1275 39.0 36.0 41.0 31.0 41.0 38 37.271 39.0 36.0 40.0 31.0 41.0 39 37.24725 39.0 36.0 41.0 31.0 41.0 40 37.031 39.0 36.0 40.0 31.0 41.0 41 36.727 39.0 35.0 40.0 30.0 41.0 42 36.607 39.0 35.0 40.0 30.0 41.0 43 36.47875 39.0 35.0 40.0 30.0 41.0 44 36.67375 39.0 35.0 40.0 30.0 41.0 45 36.0685 38.0 35.0 40.0 28.0 41.0 46 36.3445 38.0 35.0 40.0 30.0 41.0 47 36.568 38.0 35.0 40.0 30.0 41.0 48 36.15225 38.0 35.0 40.0 29.0 41.0 49 36.015 38.0 35.0 40.0 28.0 41.0 50 36.17 38.0 35.0 40.0 29.0 41.0 51 36.14525 38.0 35.0 40.0 29.0 41.0 52 35.3145 38.0 33.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2316 1 0.0 2316 2 0.0 2316 3 0.0 2316 4 0.0 2316 5 0.0 2316 6 0.0 2316 7 0.0 2316 8 0.0 2316 9 0.0 2316 10 0.0 2316 11 0.0 2316 12 0.0 2316 13 0.0 2316 14 0.0 2316 15 0.0 2316 16 0.0 2316 17 0.0 2316 18 0.0 2316 19 0.0 2316 20 0.0 2316 21 0.0 2316 22 0.0 2316 23 0.0 2316 24 0.0 2316 25 0.0 2316 26 0.0 2316 27 0.0 2316 28 0.0 2316 29 0.0 2316 30 0.0 2316 31 0.0 2316 32 0.0 2316 33 0.0 2316 34 0.0 2316 35 0.0 2316 36 0.0 2316 37 0.0 2316 38 0.0 2316 39 0.0 2316 40 0.0 2316 41 0.0 2316 42 0.0 2316 43 0.0 2316 44 0.0 2316 45 0.0 2316 46 0.0 2316 47 0.0 2316 48 0.0 2316 49 0.0 2316 50 0.0 2316 51 0.0 2316 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 7.0 24 9.0 25 16.0 26 24.0 27 30.0 28 50.0 29 80.0 30 82.0 31 122.0 32 166.0 33 203.0 34 240.0 35 276.0 36 374.0 37 528.0 38 750.0 39 1038.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.669334667333665 12.056028014007003 6.753376688344172 42.521260630315155 2 24.15 14.649999999999999 34.150000000000006 27.05 3 20.150000000000002 18.3 24.525 37.025000000000006 4 24.15 26.875 22.15 26.825 5 23.325000000000003 30.525000000000002 24.85 21.3 6 19.425 34.525 23.200000000000003 22.85 7 15.35 24.25 41.349999999999994 19.05 8 17.150000000000002 23.150000000000002 31.525 28.175 9 17.849999999999998 22.175 34.275 25.7 10 18.675 36.425000000000004 24.3 20.599999999999998 11 21.95 27.900000000000002 22.7 27.450000000000003 12 21.475 24.7 26.150000000000002 27.675 13 20.25 27.474999999999998 27.450000000000003 24.825 14 20.275000000000002 26.875 29.15 23.7 15 20.925 26.55 25.95 26.575 16 21.05 27.1 25.124999999999996 26.724999999999998 17 20.849999999999998 28.275 26.05 24.825 18 21.425 26.950000000000003 25.674999999999997 25.95 19 21.925 27.125 25.674999999999997 25.275 20 19.725 28.000000000000004 27.750000000000004 24.525 21 20.325 26.174999999999997 27.3 26.200000000000003 22 20.9 26.224999999999998 26.375 26.5 23 20.775 27.400000000000002 26.05 25.775 24 21.9 26.150000000000002 26.924999999999997 25.025 25 21.5 26.85 24.675 26.974999999999998 26 21.325 26.650000000000002 27.375 24.65 27 20.674999999999997 28.000000000000004 26.375 24.95 28 21.425 28.025 26.35 24.2 29 21.675 27.3 26.200000000000003 24.825 30 21.55 27.025 26.224999999999998 25.2 31 22.25 28.375 24.775 24.6 32 20.974999999999998 26.674999999999997 26.950000000000003 25.4 33 19.875 25.45 27.250000000000004 27.425 34 20.674999999999997 28.349999999999998 26.3 24.675 35 20.25 26.35 25.95 27.450000000000003 36 21.075 28.050000000000004 25.424999999999997 25.45 37 21.45 26.200000000000003 26.3 26.05 38 21.349999999999998 27.500000000000004 24.45 26.700000000000003 39 20.325 27.3 26.424999999999997 25.95 40 21.55 27.500000000000004 25.924999999999997 25.025 41 21.425 27.175 25.525 25.874999999999996 42 21.3 27.05 25.85 25.8 43 21.825 26.325 25.7 26.150000000000002 44 22.675 25.974999999999998 26.25 25.1 45 20.599999999999998 27.175 25.55 26.674999999999997 46 21.099999999999998 26.55 25.724999999999998 26.625 47 23.075000000000003 26.474999999999998 24.25 26.200000000000003 48 21.135567783891947 26.638319159579787 25.087543771885944 27.138569284642323 49 21.38569284642321 27.763881940970485 25.48774387193597 25.362681340670335 50 22.63631815907954 27.163581790895446 25.86293146573287 24.337168584292147 51 22.55 26.450000000000003 24.15 26.85 52 22.55 26.0 25.374999999999996 26.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.5 14 0.5 15 1.0 16 1.5 17 2.0 18 5.0 19 8.0 20 6.0 21 4.0 22 11.0 23 18.0 24 18.0 25 18.0 26 27.0 27 36.0 28 39.0 29 42.0 30 60.5 31 79.0 32 93.5 33 108.0 34 114.0 35 120.0 36 164.5 37 209.0 38 203.0 39 224.5 40 252.0 41 265.5 42 279.0 43 284.0 44 289.0 45 284.5 46 280.0 47 282.5 48 285.0 49 284.5 50 284.0 51 298.0 52 312.0 53 280.0 54 248.0 55 229.0 56 210.0 57 201.5 58 193.0 59 179.5 60 166.0 61 144.0 62 122.0 63 98.5 64 69.5 65 64.0 66 49.5 67 35.0 68 26.0 69 17.0 70 14.5 71 12.0 72 14.0 73 16.0 74 11.5 75 7.0 76 6.5 77 6.0 78 4.0 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.05 49 0.05 50 0.05 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.74540682414698 92.15 2 2.4146981627296586 4.6 3 0.5249343832020997 1.5 4 0.05249343832020997 0.2 5 0.10498687664041995 0.5 6 0.13123359580052493 0.75 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026246719160104987 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 12 0.3 No Hit GGTGCATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGT 6 0.15 No Hit GTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCCCTGCTTCCTCGG 6 0.15 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 6 0.15 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 6 0.15 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 6 0.15 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit CCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGA 5 0.125 No Hit CCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra Read 11734 spots for SRR5423371.sra Written 11734 spots for SRR5423371.sra SRR ids: ['SRR5423371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w3b6jwst SRR5423371.sra spots: 234680 blocks: [[1, 11734], [11735, 23468], [23469, 35202], [35203, 46936], [46937, 58670], [58671, 70404], [70405, 82138], [82139, 93872], [93873, 105606], [105607, 117340], [117341, 129074], [129075, 140808], [140809, 152542], [152543, 164276], [164277, 176010], [176011, 187744], [187745, 199478], [199479, 211212], [211213, 222946], [222947, 234680]] SRR5423371 file size 41046 SRR5423371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423371 SRR5423371_1.fastq Input file: SRR5423371_1.fastq trimmed: SRR5423371-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 02:59:34 2025 >> started Thu Feb 13 03:02:38 2025 >> done (184.307s) 234680 reads processed; of these: 9 ( 0.00%) short reads filtered out after trimming by size control 4 ( 0.00%) empty reads filtered out after trimming by size control 234667 (99.99%) reads available; of these: 4676 ( 1.99%) trimmed reads available after processing 229991 (98.01%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 1 0.00% 36 2 0.00% 37 0 0.00% 38 1 0.00% 39 1 0.00% 40 2 0.00% 41 1 0.00% 42 4 0.00% 43 8 0.00% 44 4 0.00% 45 7 0.00% 46 13 0.01% 47 19 0.01% 48 53 0.02% 49 114 0.05% 50 472 0.20% 51 3972 1.69% 52 229991 98.01% 234667 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=12 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=8.07 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.9 sequence=CCCCGAGCCCACTTCCAGACTGGTCATCGTCAACACGAGT Started job on | Feb 13 03:10:45 Started mapping on | Feb 13 03:10:57 Finished on | Feb 13 03:20:51 Mapping speed, Million of reads per hour | 1.42 Number of input reads | 234667 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 187622 Uniquely mapped reads % | 79.95% Average mapped length | 51.78 Number of splices: Total | 17424 Number of splices: Annotated (sjdb) | 17049 Number of splices: GT/AG | 17014 Number of splices: GC/AG | 295 Number of splices: AT/AC | 47 Number of splices: Non-canonical | 68 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 23817 % of reads mapped to multiple loci | 10.15% Number of reads mapped to too many loci | 16770 % of reads mapped to too many loci | 7.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 23228 23228 23228 N_multimapping 23817 23817 23817 N_noFeature 32124 183470 35747 N_ambiguous 1082 2 552 UnstrandedReadsAssigned:154416 PositiveStrandReadsAssigned:4150 NegativeStrandReadsAssigned:151323 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423371 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423371-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 234,667 reads, 177,717 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 814 rounds 52401 SRR5423371.ke.tsv 34699 SRR5423371.se.tsv 87100 total ==> SRR5423371.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 12 38.0793 Potri.005G024800.1.v4.1 1035 936 4 26.0236 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 5 10.7059 Potri.016G087400.1.v4.1 270 171 0 0 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 5 34.6783 ==> SRR5423371.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 2 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423371 completed mapping pipeline successfully