Starting /dee2/code/volunteer_pipeline.sh SRR5423372 current disk space = 3052034240512 free memory = 1580831580 SRR5423372 SRAfilesize 7d6d38799e8212bb5091866667562fa1 SRR5423372.sra SRR5423372.sra file validated SRR5423372 is single end SRR5423372 is conventional basespace SRR5423372 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.49025 16.0 16.0 26.0 16.0 30.0 2 22.44225 25.0 16.0 30.0 16.0 30.0 3 23.847 26.0 16.0 30.0 16.0 31.0 4 28.7475 32.0 19.0 35.0 19.0 35.0 5 23.0045 19.0 19.0 30.0 10.0 35.0 6 22.09225 17.0 17.0 30.0 10.0 33.0 7 23.1405 25.0 17.0 32.0 10.0 33.0 8 24.27575 27.0 17.0 32.0 15.0 35.0 9 24.21375 27.0 17.0 32.0 11.0 35.0 10 26.44525 28.0 17.0 34.0 17.0 35.0 11 26.98275 30.0 17.0 34.0 15.0 35.0 12 25.93725 27.0 17.0 34.0 11.0 35.0 13 26.07675 27.0 17.0 34.0 11.0 35.0 14 27.23925 30.0 18.0 34.0 16.0 36.0 15 28.0395 31.0 25.0 34.0 16.0 37.0 16 27.634 31.0 19.0 34.0 11.0 37.0 17 27.917 31.0 25.0 34.0 16.0 37.0 18 24.947 27.0 17.0 33.0 10.0 36.0 19 26.86275 29.0 18.0 34.0 11.0 37.0 20 26.2695 27.0 18.0 34.0 10.0 37.0 21 27.12625 30.0 19.0 34.0 11.0 37.0 22 27.1065 30.0 19.0 34.0 11.0 37.0 23 25.98375 27.0 18.0 34.0 10.0 37.0 24 25.899 27.0 18.0 34.0 10.0 37.0 25 25.0215 27.0 17.0 33.0 10.0 36.0 26 21.74175 23.0 10.0 31.0 9.0 35.0 27 21.97825 24.0 11.0 31.0 9.0 34.0 28 23.04525 25.0 15.0 32.0 9.0 35.0 29 23.68475 25.0 16.0 32.0 9.0 36.0 30 24.035 25.0 16.0 32.0 9.0 36.0 31 24.36125 27.0 16.0 33.0 9.0 36.0 32 19.69525 17.0 9.0 30.0 8.0 34.0 33 20.91925 23.0 10.0 30.0 8.0 34.0 34 22.171 24.0 15.0 30.0 9.0 35.0 35 22.27175 25.0 14.0 30.0 9.0 35.0 36 20.73125 22.0 9.0 30.0 8.0 34.0 37 20.56825 21.0 9.0 30.0 8.0 34.0 38 20.58075 22.0 9.0 30.0 8.0 34.0 39 21.2515 24.0 11.0 30.0 8.0 34.0 40 21.23425 23.0 9.0 30.0 8.0 34.0 41 21.5915 24.0 13.0 30.0 8.0 34.0 42 21.2745 23.0 11.0 30.0 8.0 35.0 43 21.48025 24.0 12.0 30.0 8.0 34.0 44 21.845 24.0 13.0 30.0 8.0 35.0 45 21.5395 23.0 12.0 30.0 8.0 34.0 46 20.719 22.0 9.0 30.0 8.0 34.0 47 20.26525 21.0 9.0 30.0 8.0 33.0 48 20.61575 23.0 10.0 30.0 8.0 33.0 49 19.478 19.0 9.0 28.0 7.0 33.0 50 19.5755 20.0 9.0 28.0 7.0 33.0 51 17.92475 15.0 9.0 26.0 7.0 32.0 52 17.39775 15.0 8.0 25.0 7.0 31.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.5438091320444265 1112 2 0.07599753187988512 1112 3 0.2629576306046886 1112 4 0.5482311805841213 1112 5 0.21359522830110933 1112 6 -0.8018305224187579 1112 7 0.5166598107774583 1112 8 1.23951048951049 1112 9 -0.7894899218428613 1112 10 0.8263060468942811 1112 11 0.22552447552447674 1112 12 -0.6366721513780362 1112 13 -1.2322089675030838 1112 14 -0.2388934594816945 1112 15 -0.6276223776223766 1112 16 0.5397984368572608 1112 17 1.2162690250925543 1112 18 -0.3307280954339795 1112 19 1.1075689016865482 1112 20 -0.6072603866721522 1112 21 0.3011106540518327 1112 22 -0.555532702591524 1112 23 -1.0020567667626494 1112 24 -1.6307075277663508 1112 25 -0.7288153023447137 1112 26 0.2963800904977383 1112 27 -0.4175236528177706 1112 28 0.3408062525709603 1112 29 -0.7434183463595225 1112 30 -1.6479843685726046 1112 31 -0.8335047305635541 1112 32 -0.996709173179763 1112 33 -1.1907651172357063 1112 34 -1.092143150966681 1112 35 -1.2696421225832992 1112 36 -0.08802961744138216 1112 37 -0.015837104072396357 1112 38 -0.08741258741259017 1112 39 -0.5847387906211452 1112 40 -2.0843274372686125 1112 41 -1.502982311805841 1112 42 -2.1987865076100377 1112 43 -0.44816947758124215 1112 44 -0.4995886466474708 1112 45 -0.18716577540106982 1112 46 -0.37823940765117214 1112 47 -1.5927601809954766 1112 48 -0.21678321678321666 1112 49 -1.5331139448786502 1112 50 -0.65034965034965 1112 51 -0.7924722336487022 1112 52 -0.24382969971205526 1113 1 -0.5438091320444265 1113 2 -0.07599753187988156 1113 3 -0.2629576306046921 1113 4 -0.5482311805841213 1113 5 -0.21359522830111288 1113 6 0.8018305224187579 1113 7 -0.5166598107774583 1113 8 -1.23951048951049 1113 9 0.7894899218428648 1113 10 -0.8263060468942811 1113 11 -0.22552447552447674 1113 12 0.6366721513780327 1113 13 1.2322089675030874 1113 14 0.2388934594816945 1113 15 0.6276223776223802 1113 16 -0.5397984368572608 1113 17 -1.2162690250925543 1113 18 0.33072809543397597 1113 19 -1.1075689016865482 1113 20 0.6072603866721522 1113 21 -0.30111065405182913 1113 22 0.5555327025915275 1113 23 1.0020567667626494 1113 24 1.6307075277663508 1113 25 0.7288153023447173 1113 26 -0.2963800904977383 1113 27 0.4175236528177706 1113 28 -0.34080625257095676 1113 29 0.7434183463595225 1113 30 1.6479843685726046 1113 31 0.8335047305635541 1113 32 0.9967091731797595 1113 33 1.1907651172357063 1113 34 1.092143150966681 1113 35 1.2696421225832992 1113 36 0.08802961744138216 1113 37 0.01583710407239991 1113 38 0.08741258741258662 1113 39 0.5847387906211452 1113 40 2.0843274372686125 1113 41 1.502982311805841 1113 42 2.1987865076100377 1113 43 0.44816947758124215 1113 44 0.4995886466474708 1113 45 0.18716577540106982 1113 46 0.37823940765117214 1113 47 1.5927601809954766 1113 48 0.21678321678321666 1113 49 1.5331139448786502 1113 50 0.65034965034965 1113 51 0.7924722336487058 1113 52 0.2438296997120517 >>END_MODULE >>Per sequence quality scores warn #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 5.0 14 13.0 15 26.0 16 74.0 17 110.0 18 138.0 19 266.0 20 316.0 21 406.0 22 482.0 23 477.0 24 477.0 25 392.0 26 334.0 27 206.0 28 142.0 29 80.0 30 36.0 31 14.0 32 1.0 33 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.7344336084021 15.25381345336334 6.026506626656665 40.985246311577896 2 22.225 15.174999999999999 36.025 26.575 3 19.0 18.65 25.45 36.9 4 23.150000000000002 26.0 21.675 29.175 5 35.65 25.650000000000002 10.875 27.825 6 20.525 31.6 23.775 24.099999999999998 7 13.625000000000002 23.375 42.525 20.474999999999998 8 20.4 21.8 31.924999999999997 25.874999999999996 9 19.275000000000002 21.6 35.05 24.075 10 17.5 34.875 26.625 21.0 11 21.4 27.900000000000002 23.150000000000002 27.55 12 23.1 23.375 26.924999999999997 26.6 13 19.975 26.0 28.7 25.324999999999996 14 19.225 28.075 28.000000000000004 24.7 15 19.775000000000002 25.5 27.125 27.6 16 20.9 26.650000000000002 26.775 25.674999999999997 17 20.849999999999998 28.475 24.825 25.85 18 21.325 29.7 24.25 24.725 19 20.9 27.800000000000004 23.95 27.35 20 21.475 28.65 24.4 25.474999999999998 21 20.05 24.425 28.925 26.6 22 22.125 27.975 23.25 26.650000000000002 23 22.575 27.55 24.45 25.424999999999997 24 19.825 30.25 24.474999999999998 25.45 25 22.125 28.299999999999997 22.125 27.450000000000003 26 23.0 28.175 24.2 24.625 27 21.825 28.125 26.150000000000002 23.9 28 23.0 27.450000000000003 24.125 25.424999999999997 29 23.400000000000002 27.400000000000002 24.925 24.275 30 20.3 27.05 27.725 24.925 31 20.875 27.200000000000003 27.625 24.3 32 23.775 28.225 23.075000000000003 24.925 33 19.925 27.450000000000003 24.8 27.825 34 18.325 28.65 25.8 27.224999999999998 35 23.150000000000002 26.650000000000002 24.875 25.324999999999996 36 21.7 27.55 23.9 26.85 37 20.325 28.425 25.874999999999996 25.374999999999996 38 21.875 31.900000000000002 21.65 24.575 39 23.25 27.500000000000004 22.975 26.275 40 20.275000000000002 31.25 22.775000000000002 25.7 41 19.425 25.45 28.050000000000004 27.075 42 21.0 27.6 26.400000000000002 25.0 43 20.8 30.5 22.95 25.75 44 22.475 28.000000000000004 23.799999999999997 25.724999999999998 45 23.474999999999998 27.125 22.425 26.974999999999998 46 21.525 28.199999999999996 24.675 25.6 47 22.75 26.6 24.95 25.7 48 23.6368184092046 28.564282141070535 25.137568784392194 22.661330665332667 49 23.35 26.875 26.650000000000002 23.125 50 24.956239059764943 26.506626656664167 22.755688922230558 25.78144536134033 51 21.375 28.875 21.975 27.775 52 22.7 29.95 22.5 24.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 2.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.0 22 5.0 23 9.0 24 18.0 25 27.0 26 39.5 27 52.0 28 56.5 29 61.0 30 78.5 31 96.0 32 110.5 33 125.0 34 128.5 35 132.0 36 156.5 37 181.0 38 197.5 39 236.5 40 259.0 41 257.0 42 255.0 43 263.0 44 271.0 45 273.5 46 276.0 47 272.5 48 269.0 49 256.5 50 244.0 51 234.0 52 224.0 53 239.0 54 254.0 55 225.5 56 197.0 57 200.0 58 203.0 59 175.5 60 148.0 61 128.0 62 108.0 63 106.5 64 94.0 65 83.0 66 65.0 67 47.0 68 39.5 69 32.0 70 31.5 71 31.0 72 21.0 73 11.0 74 18.0 75 25.0 76 23.0 77 21.0 78 16.5 79 12.0 80 9.5 81 7.0 82 7.0 83 7.0 84 5.0 85 3.0 86 3.0 87 3.0 88 2.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.05 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.31847133757961 96.475 2 1.5031847133757963 2.9499999999999997 3 0.12738853503184713 0.375 4 0.05095541401273885 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6598 spots for SRR5423372.sra Written 6598 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Read 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra Written 6592 spots for SRR5423372.sra SRR ids: ['SRR5423372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gd518j3f SRR5423372.sra spots: 131846 blocks: [[1, 6592], [6593, 13184], [13185, 19776], [19777, 26368], [26369, 32960], [32961, 39552], [39553, 46144], [46145, 52736], [52737, 59328], [59329, 65920], [65921, 72512], [72513, 79104], [79105, 85696], [85697, 92288], [92289, 98880], [98881, 105472], [105473, 112064], [112065, 118656], [118657, 125248], [125249, 131846]] SRR5423372 file size 23000 SRR5423372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423372 SRR5423372_1.fastq Input file: SRR5423372_1.fastq trimmed: SRR5423372-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 03:19:46 2025 >> started Thu Feb 13 03:22:17 2025 >> done (151.137s) 131846 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 131846 (100.00%) reads available; of these: 27893 (21.16%) trimmed reads available after processing 103953 (78.84%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 35 2 0.00% 36 0 0.00% 37 2 0.00% 38 0 0.00% 39 3 0.00% 40 3 0.00% 41 2 0.00% 42 5 0.00% 43 17 0.01% 44 26 0.02% 45 39 0.03% 46 100 0.08% 47 228 0.17% 48 539 0.41% 49 1571 1.19% 50 5117 3.88% 51 20239 15.35% 52 103953 78.84% 131846 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=10 prefix-density=0.00 prefix-fanout=1.0 sequence=CCCCCGAGCCCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=15.30 fanout-score-rank=1 prefix-density=1.18 prefix-fanout=1.2 sequence=CCGCCGCTCGGGGGGAA Started job on | Feb 13 03:24:15 Started mapping on | Feb 13 03:24:31 Finished on | Feb 13 03:25:06 Mapping speed, Million of reads per hour | 13.56 Number of input reads | 131846 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 98067 Uniquely mapped reads % | 74.38% Average mapped length | 51.26 Number of splices: Total | 7898 Number of splices: Annotated (sjdb) | 7693 Number of splices: GT/AG | 7729 Number of splices: GC/AG | 108 Number of splices: AT/AC | 29 Number of splices: Non-canonical | 32 Mismatch rate per base, % | 2.97% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 13402 % of reads mapped to multiple loci | 10.16% Number of reads mapped to too many loci | 8310 % of reads mapped to too many loci | 6.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.13% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 20377 20377 20377 N_multimapping 13402 13402 13402 N_noFeature 16416 95880 18357 N_ambiguous 470 3 221 UnstrandedReadsAssigned:81181 PositiveStrandReadsAssigned:2184 NegativeStrandReadsAssigned:79489 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=51 echo kmer=47 SRR5423372 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423372-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 131,846 reads, 63,142 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 735 rounds 52401 SRR5423372.ke.tsv 34699 SRR5423372.se.tsv 87100 total ==> SRR5423372.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 8 72.1965 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 0 0 Potri.016G087400.1.v4.1 270 171 0 0 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 3 31.0361 Potri.012G127500.1.v4.1 977 878 3 59.1736 ==> SRR5423372.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 0 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423372 completed mapping pipeline successfully