Starting /dee2/code/volunteer_pipeline.sh SRR5423373 current disk space = 3052101115904 free memory = 1580088200 SRR5423373 SRAfilesize 82ecc4eb7bb53cd501ef3900071a87fd SRR5423373.sra SRR5423373.sra file validated SRR5423373 is single end SRR5423373 is conventional basespace SRR5423373 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.739 31.0 30.0 33.0 28.0 34.0 2 31.27075 31.0 31.0 34.0 28.0 34.0 3 31.57975 31.0 31.0 34.0 28.0 34.0 4 30.46725 35.0 28.0 37.0 16.0 37.0 5 33.85875 35.0 33.0 37.0 28.0 37.0 6 34.8145 35.0 35.0 37.0 32.0 37.0 7 35.07525 35.0 35.0 37.0 32.0 37.0 8 35.2045 37.0 35.0 37.0 33.0 37.0 9 36.6245 39.0 35.0 39.0 32.0 39.0 10 36.724 39.0 35.0 39.0 32.0 39.0 11 36.6985 39.0 37.0 39.0 32.0 39.0 12 36.86875 39.0 37.0 39.0 33.0 39.0 13 36.85125 39.0 37.0 39.0 32.0 39.0 14 37.813 40.0 37.0 41.0 32.0 41.0 15 37.697 40.0 37.0 41.0 32.0 41.0 16 37.995 40.0 37.0 41.0 33.0 41.0 17 37.97775 40.0 37.0 41.0 33.0 41.0 18 38.0915 40.0 37.0 41.0 33.0 41.0 19 37.94625 40.0 37.0 41.0 32.0 41.0 20 38.05725 40.0 37.0 41.0 33.0 41.0 21 38.10775 40.0 37.0 41.0 33.0 41.0 22 37.91825 40.0 37.0 41.0 33.0 41.0 23 38.0765 40.0 37.0 41.0 33.0 41.0 24 38.00525 40.0 37.0 41.0 33.0 41.0 25 37.755 40.0 37.0 41.0 32.0 41.0 26 37.66375 40.0 37.0 41.0 32.0 41.0 27 37.66525 40.0 37.0 41.0 32.0 41.0 28 37.581 40.0 37.0 41.0 32.0 41.0 29 37.62625 40.0 37.0 41.0 32.0 41.0 30 37.45475 40.0 37.0 41.0 31.0 41.0 31 37.467 39.0 36.0 41.0 31.0 41.0 32 37.51275 39.0 36.0 41.0 32.0 41.0 33 37.569 39.0 37.0 41.0 32.0 41.0 34 37.467 39.0 36.0 41.0 31.0 41.0 35 37.421 39.0 37.0 41.0 32.0 41.0 36 37.1835 39.0 36.0 41.0 31.0 41.0 37 37.42475 40.0 36.0 41.0 31.0 41.0 38 37.13925 39.0 36.0 41.0 30.0 41.0 39 37.32875 39.0 36.0 41.0 31.0 41.0 40 37.237 39.0 36.0 41.0 31.0 41.0 41 37.07475 39.0 36.0 41.0 31.0 41.0 42 36.96125 39.0 36.0 41.0 30.0 41.0 43 36.93175 39.0 35.0 40.0 31.0 41.0 44 36.9645 39.0 35.0 40.0 31.0 41.0 45 36.8525 39.0 35.0 40.0 31.0 41.0 46 36.51 39.0 35.0 40.0 30.0 41.0 47 36.255 38.0 35.0 40.0 29.0 41.0 48 36.316 39.0 35.0 40.0 29.0 41.0 49 36.262 38.0 35.0 40.0 29.0 41.0 50 36.322 39.0 35.0 40.0 29.0 41.0 51 36.21925 38.0 35.0 40.0 29.0 41.0 52 35.22275 38.0 33.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 4.0 21 2.0 22 4.0 23 6.0 24 6.0 25 9.0 26 19.0 27 32.0 28 42.0 29 65.0 30 95.0 31 129.0 32 154.0 33 180.0 34 242.0 35 323.0 36 389.0 37 516.0 38 758.0 39 1021.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.93039559339009 12.018027040560842 6.359539308963445 44.692038057085625 2 22.975 14.149999999999999 34.599999999999994 28.275 3 21.75 18.875 23.35 36.025 4 23.65 25.775 23.625 26.950000000000003 5 23.9 29.925 23.474999999999998 22.7 6 19.525000000000002 34.025 24.5 21.95 7 14.725 23.325000000000003 41.875 20.075000000000003 8 17.8 23.474999999999998 30.325000000000003 28.4 9 17.974999999999998 21.0 34.275 26.75 10 18.25 38.175 24.875 18.7 11 22.375 27.6 22.25 27.775 12 21.6 23.724999999999998 26.724999999999998 27.950000000000003 13 19.775000000000002 28.050000000000004 28.449999999999996 23.724999999999998 14 20.225 27.025 27.55 25.2 15 20.5 27.650000000000002 26.674999999999997 25.174999999999997 16 19.975 26.6 26.724999999999998 26.700000000000003 17 21.5 26.125 26.1 26.275 18 20.849999999999998 27.950000000000003 25.674999999999997 25.525 19 21.675 26.8 25.95 25.575 20 19.825 26.35 28.249999999999996 25.575 21 20.325 25.924999999999997 26.724999999999998 27.025 22 20.05 26.650000000000002 26.075 27.224999999999998 23 20.65 27.950000000000003 25.35 26.05 24 21.175 27.775 24.95 26.1 25 21.0 27.6 25.2 26.200000000000003 26 20.674999999999997 27.1 26.125 26.1 27 22.075 27.925 25.25 24.75 28 21.425 27.675 26.55 24.349999999999998 29 22.8 26.825 25.775 24.6 30 20.825 26.724999999999998 26.150000000000002 26.3 31 21.9 27.950000000000003 25.275 24.875 32 20.775 26.35 27.575 25.3 33 20.95 27.675 25.95 25.424999999999997 34 20.375 27.075 26.950000000000003 25.6 35 20.849999999999998 27.500000000000004 25.275 26.375 36 20.5 26.5 25.650000000000002 27.35 37 20.625 25.924999999999997 25.5 27.950000000000003 38 20.775 27.625 25.374999999999996 26.224999999999998 39 21.925 24.425 26.325 27.325 40 21.425 28.449999999999996 24.625 25.5 41 21.7 26.8 25.474999999999998 26.025 42 20.7 26.525 25.974999999999998 26.8 43 21.375 26.875 26.025 25.724999999999998 44 21.575 26.900000000000002 25.674999999999997 25.85 45 21.65 25.275 25.85 27.224999999999998 46 22.825 25.924999999999997 25.35 25.900000000000002 47 22.3 25.45 26.55 25.7 48 22.05 25.724999999999998 25.074999999999996 27.150000000000002 49 22.3 26.05 25.374999999999996 26.275 50 21.175 26.775 24.675 27.375 51 21.75 26.650000000000002 25.3 26.3 52 22.45 25.724999999999998 24.8 27.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 3.5 19 5.0 20 7.5 21 10.0 22 12.5 23 15.0 24 17.5 25 20.0 26 21.5 27 23.0 28 34.5 29 46.0 30 60.0 31 74.0 32 90.0 33 106.0 34 110.5 35 115.0 36 138.0 37 161.0 38 186.5 39 239.0 40 266.0 41 266.5 42 267.0 43 280.5 44 294.0 45 291.5 46 289.0 47 292.5 48 296.0 49 301.0 50 306.0 51 290.5 52 275.0 53 282.5 54 290.0 55 247.5 56 205.0 57 200.5 58 196.0 59 181.0 60 166.0 61 137.0 62 108.0 63 99.0 64 70.0 65 50.0 66 41.5 67 33.0 68 28.0 69 23.0 70 18.5 71 14.0 72 18.5 73 23.0 74 16.0 75 9.0 76 5.5 77 2.0 78 2.5 79 3.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 1.5 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.6 #Duplication Level Percentage of deduplicated Percentage of total 1 97.1234309623431 92.85 2 2.092050209205021 4.0 3 0.47071129707112974 1.35 4 0.15690376569037656 0.6 5 0.05230125523012552 0.25 6 0.02615062761506276 0.15 7 0.02615062761506276 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05230125523012552 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 14 0.35000000000000003 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 11 0.27499999999999997 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 7 0.17500000000000002 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 6 0.15 No Hit CCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGA 5 0.125 No Hit CCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra Read 200000 spots for SRR5423373.sra Written 200000 spots for SRR5423373.sra SRR ids: ['SRR5423373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w25i42on SRR5423373.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423373 file size 703975 SRR5423373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423373 SRR5423373_1.fastq Input file: SRR5423373_1.fastq trimmed: SRR5423373-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 03:13:53 2025 >> started Thu Feb 13 03:19:27 2025 >> done (334.746s) 4000000 reads processed; of these: 116 ( 0.00%) short reads filtered out after trimming by size control 86 ( 0.00%) empty reads filtered out after trimming by size control 3999798 (99.99%) reads available; of these: 118871 ( 2.97%) trimmed reads available after processing 3880927 (97.03%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 6 0.00% 25 5 0.00% 26 10 0.00% 27 22 0.00% 28 21 0.00% 29 21 0.00% 30 28 0.00% 31 35 0.00% 32 53 0.00% 33 70 0.00% 34 52 0.00% 35 66 0.00% 36 61 0.00% 37 104 0.00% 38 108 0.00% 39 108 0.00% 40 146 0.00% 41 170 0.00% 42 269 0.01% 43 305 0.01% 44 471 0.01% 45 674 0.02% 46 982 0.02% 47 1595 0.04% 48 2930 0.07% 49 5880 0.15% 50 16005 0.40% 51 88663 2.22% 52 3880927 97.03% 3999798 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.21 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=9.64 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.0 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCCC Started job on | Feb 13 03:24:40 Started mapping on | Feb 13 03:24:59 Finished on | Feb 13 03:43:47 Mapping speed, Million of reads per hour | 12.77 Number of input reads | 3999798 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3198153 Uniquely mapped reads % | 79.96% Average mapped length | 51.75 Number of splices: Total | 297928 Number of splices: Annotated (sjdb) | 291107 Number of splices: GT/AG | 290540 Number of splices: GC/AG | 5242 Number of splices: AT/AC | 760 Number of splices: Non-canonical | 1386 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409791 % of reads mapped to multiple loci | 10.25% Number of reads mapped to too many loci | 275803 % of reads mapped to too many loci | 6.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 391854 391854 391854 N_multimapping 409791 409791 409791 N_noFeature 540633 3124535 605505 N_ambiguous 17850 136 8992 UnstrandedReadsAssigned:2639670 PositiveStrandReadsAssigned:73482 NegativeStrandReadsAssigned:2583656 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423373 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423373-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,798 reads, 3,007,031 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR5423373.ke.tsv 34699 SRR5423373.se.tsv 87100 total ==> SRR5423373.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 302.798 57.4068 Potri.005G024800.1.v4.1 1035 936 31 12.0496 Potri.004G059700.1.v4.1 961 862 2 0.844129 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 83.6513 10.7011 Potri.016G087400.1.v4.1 270 171 16 34.0416 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 11 2.39069 Potri.012G127500.1.v4.1 977 878 93 38.5367 ==> SRR5423373.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 43 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423373 completed mapping pipeline successfully