Starting /dee2/code/volunteer_pipeline.sh SRR5423374 current disk space = 3052121219072 free memory = 1580914928 SRR5423374 SRAfilesize 56f3cc27df607caa9dc802582f7e7074 SRR5423374.sra SRR5423374.sra file validated SRR5423374 is single end SRR5423374 is conventional basespace SRR5423374 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423374_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06025 33.0 31.0 34.0 30.0 34.0 2 32.09 34.0 31.0 34.0 30.0 34.0 3 32.23925 34.0 31.0 34.0 30.0 34.0 4 35.322 37.0 35.0 37.0 32.0 37.0 5 35.629 37.0 35.0 37.0 33.0 37.0 6 35.61825 37.0 35.0 37.0 33.0 37.0 7 35.611 37.0 35.0 37.0 33.0 37.0 8 35.43225 37.0 35.0 37.0 33.0 37.0 9 37.338 39.0 37.0 39.0 34.0 39.0 10 37.3925 39.0 37.0 39.0 34.0 39.0 11 37.47375 39.0 37.0 39.0 35.0 39.0 12 37.46875 39.0 37.0 39.0 34.0 39.0 13 37.0775 39.0 37.0 39.0 33.0 39.0 14 38.73875 40.0 38.0 41.0 34.0 41.0 15 38.54425 40.0 38.0 41.0 34.0 41.0 16 38.6225 40.0 38.0 41.0 34.0 41.0 17 38.69675 40.0 38.0 41.0 34.0 41.0 18 38.6635 40.0 38.0 41.0 34.0 41.0 19 38.84425 40.0 38.0 41.0 35.0 41.0 20 38.6955 40.0 38.0 41.0 34.0 41.0 21 38.5825 40.0 38.0 41.0 34.0 41.0 22 38.63475 40.0 38.0 41.0 34.0 41.0 23 38.65325 40.0 38.0 41.0 34.0 41.0 24 38.26325 40.0 38.0 41.0 33.0 41.0 25 38.3225 40.0 38.0 41.0 33.0 41.0 26 38.241 40.0 38.0 41.0 33.0 41.0 27 38.35225 40.0 38.0 41.0 34.0 41.0 28 38.2655 40.0 38.0 41.0 33.0 41.0 29 38.20075 40.0 38.0 41.0 33.0 41.0 30 38.16125 40.0 38.0 41.0 34.0 41.0 31 38.25375 40.0 38.0 41.0 33.0 41.0 32 37.9825 40.0 38.0 41.0 33.0 41.0 33 37.97525 40.0 38.0 41.0 33.0 41.0 34 37.999 40.0 37.0 41.0 33.0 41.0 35 38.0155 40.0 37.0 41.0 33.0 41.0 36 37.515 40.0 37.0 41.0 31.0 41.0 37 37.75375 40.0 37.0 41.0 32.0 41.0 38 37.47075 40.0 37.0 41.0 31.0 41.0 39 37.64425 40.0 37.0 41.0 32.0 41.0 40 37.5475 40.0 37.0 41.0 31.0 41.0 41 37.602 40.0 37.0 41.0 32.0 41.0 42 37.61275 40.0 37.0 41.0 32.0 41.0 43 37.32675 40.0 37.0 41.0 31.0 41.0 44 37.50125 40.0 37.0 41.0 32.0 41.0 45 37.295 40.0 36.0 41.0 31.0 41.0 46 37.16425 40.0 36.0 41.0 31.0 41.0 47 37.04825 39.0 36.0 41.0 30.0 41.0 48 36.95975 39.0 36.0 41.0 30.0 41.0 49 36.68775 39.0 35.0 41.0 30.0 41.0 50 36.747 39.0 35.0 41.0 30.0 41.0 51 36.84725 39.0 35.0 41.0 30.0 41.0 52 35.15875 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1209 1 0.0 1209 2 0.0 1209 3 0.0 1209 4 0.0 1209 5 0.0 1209 6 0.0 1209 7 0.0 1209 8 0.0 1209 9 0.0 1209 10 0.0 1209 11 0.0 1209 12 0.0 1209 13 0.0 1209 14 0.0 1209 15 0.0 1209 16 0.0 1209 17 0.0 1209 18 0.0 1209 19 0.0 1209 20 0.0 1209 21 0.0 1209 22 0.0 1209 23 0.0 1209 24 0.0 1209 25 0.0 1209 26 0.0 1209 27 0.0 1209 28 0.0 1209 29 0.0 1209 30 0.0 1209 31 0.0 1209 32 0.0 1209 33 0.0 1209 34 0.0 1209 35 0.0 1209 36 0.0 1209 37 0.0 1209 38 0.0 1209 39 0.0 1209 40 0.0 1209 41 0.0 1209 42 0.0 1209 43 0.0 1209 44 0.0 1209 45 0.0 1209 46 0.0 1209 47 0.0 1209 48 0.0 1209 49 0.0 1209 50 0.0 1209 51 0.0 1209 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 6.0 23 5.0 24 9.0 25 14.0 26 23.0 27 31.0 28 36.0 29 33.0 30 55.0 31 79.0 32 120.0 33 139.0 34 168.0 35 236.0 36 337.0 37 458.0 38 671.0 39 1570.0 40 10.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.17447981950364 12.308849335673102 6.091752318876911 45.42491852594635 2 22.875 15.6 35.05 26.474999999999998 3 22.025 16.75 25.074999999999996 36.15 4 25.324999999999996 26.400000000000002 21.0 27.275 5 24.825 30.725 23.65 20.8 6 19.0 33.75 24.55 22.7 7 15.125 23.200000000000003 42.925000000000004 18.75 8 17.075000000000003 23.275000000000002 30.625000000000004 29.025000000000002 9 17.5 21.95 33.5 27.05 10 18.875 37.3 24.05 19.775000000000002 11 22.95 27.200000000000003 21.45 28.4 12 21.725 23.674999999999997 26.875 27.725 13 19.15 28.449999999999996 27.1 25.3 14 19.85 27.625 27.6 24.925 15 20.375 27.325 27.35 24.95 16 20.125 26.950000000000003 25.85 27.075 17 21.125 27.325 25.624999999999996 25.924999999999997 18 20.1 27.3 25.924999999999997 26.674999999999997 19 21.8 26.424999999999997 26.275 25.5 20 20.349999999999998 28.000000000000004 26.775 24.875 21 21.099999999999998 27.400000000000002 26.224999999999998 25.275 22 21.099999999999998 27.800000000000004 25.825 25.275 23 20.549999999999997 26.974999999999998 26.700000000000003 25.775 24 21.375 26.150000000000002 25.7 26.775 25 21.575 26.650000000000002 25.424999999999997 26.35 26 21.175 26.325 27.150000000000002 25.35 27 22.125 26.450000000000003 26.3 25.124999999999996 28 22.675 26.3 26.05 24.975 29 21.375 25.825 27.925 24.875 30 21.275 27.375 26.3 25.05 31 20.325 27.875 26.650000000000002 25.15 32 22.175 26.400000000000002 26.424999999999997 25.0 33 21.3 26.75 26.575 25.374999999999996 34 21.75 26.6 25.3 26.35 35 20.4 26.474999999999998 26.700000000000003 26.424999999999997 36 20.849999999999998 26.5 25.85 26.8 37 21.975 25.924999999999997 25.624999999999996 26.474999999999998 38 21.75 27.200000000000003 25.324999999999996 25.724999999999998 39 20.674999999999997 26.974999999999998 26.875 25.474999999999998 40 22.2 25.575 25.525 26.700000000000003 41 21.65 26.025 25.8 26.525 42 20.424999999999997 26.075 25.224999999999998 28.275 43 22.475 26.625 25.3 25.6 44 21.099999999999998 27.450000000000003 25.674999999999997 25.775 45 21.575 27.35 25.974999999999998 25.1 46 22.650000000000002 25.45 26.3 25.6 47 21.875 26.275 26.125 25.724999999999998 48 21.875 25.55 25.575 27.0 49 22.650000000000002 26.424999999999997 24.9 26.025 50 21.45 26.924999999999997 25.1 26.525 51 21.975 26.275 25.0 26.75 52 22.0 26.924999999999997 25.974999999999998 25.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.5 15 2.0 16 3.5 17 5.0 18 6.5 19 8.0 20 6.0 21 4.0 22 11.0 23 18.0 24 19.5 25 21.0 26 28.5 27 36.0 28 47.5 29 59.0 30 67.0 31 75.0 32 82.0 33 89.0 34 109.0 35 129.0 36 137.0 37 145.0 38 183.0 39 237.0 40 253.0 41 250.0 42 247.0 43 265.5 44 284.0 45 287.5 46 291.0 47 303.5 48 316.0 49 293.5 50 271.0 51 271.5 52 272.0 53 287.5 54 303.0 55 261.5 56 220.0 57 210.0 58 200.0 59 180.5 60 161.0 61 147.0 62 133.0 63 102.0 64 66.5 65 62.0 66 47.0 67 32.0 68 27.0 69 22.0 70 16.0 71 10.0 72 10.5 73 11.0 74 11.0 75 11.0 76 9.5 77 8.0 78 5.5 79 3.0 80 3.0 81 3.0 82 1.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 96.8790978232363 92.35 2 2.1243115656963023 4.05 3 0.6294256490952006 1.7999999999999998 4 0.15735641227380015 0.6 5 0.05245213742460005 0.25 6 0.1049042748492001 0.6 7 0.05245213742460005 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 7 0.17500000000000002 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 6 0.15 No Hit CTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAG 6 0.15 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 6 0.15 No Hit CCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGG 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra Read 200000 spots for SRR5423374.sra Written 200000 spots for SRR5423374.sra SRR ids: ['SRR5423374.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_500oc6os SRR5423374.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423374 file size 703982 SRR5423374 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423374 SRR5423374_1.fastq Input file: SRR5423374_1.fastq trimmed: SRR5423374-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 03:09:56 2025 >> started Thu Feb 13 03:13:01 2025 >> done (184.669s) 4000000 reads processed; of these: 108 ( 0.00%) short reads filtered out after trimming by size control 77 ( 0.00%) empty reads filtered out after trimming by size control 3999815 (100.00%) reads available; of these: 102725 ( 2.57%) trimmed reads available after processing 3897090 (97.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 5 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 3 0.00% 25 3 0.00% 26 8 0.00% 27 8 0.00% 28 14 0.00% 29 16 0.00% 30 13 0.00% 31 22 0.00% 32 41 0.00% 33 45 0.00% 34 56 0.00% 35 39 0.00% 36 43 0.00% 37 56 0.00% 38 66 0.00% 39 79 0.00% 40 98 0.00% 41 135 0.00% 42 179 0.00% 43 238 0.01% 44 356 0.01% 45 482 0.01% 46 712 0.02% 47 1231 0.03% 48 2321 0.06% 49 4907 0.12% 50 13171 0.33% 51 78369 1.96% 52 3897090 97.43% 3999815 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=33.41 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.4 sequence=TGGGCCGAGTTTAATTTAATTGCAATTCAATTACGAGAATGAACATTAATTAGTGGATTACAACGTATCCATTGCTTGGAATTCAAATTTAATCTCCTTCCATACTTCACAAGCAGCAGCTAGTTCAGGGCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAGATCACGTCCCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGCACCGGGTGCATTTCCCCAAGGGTGCCCTAAAGTTCCTCCACCGAATTGTAGTACGGAATCATCTCCAAAGATCTCGGTCAGAGCAGGCATATGCCAAACGTGAATACCCCCCGAAGCCACGGGTAGAACACCCGGTAGAGAGACCCAATCTTGAGTGAAATAAATACCGCGGCTTCGATCTTTTTCAACAAAATCATCACGCAGTAAATCAACAAAACCCAAAGTTATGTCTCTTTCCCCTTCAAGTTTACCTACTACGGTACCAGAGTGAATA Started job on | Feb 13 03:17:30 Started mapping on | Feb 13 03:17:47 Finished on | Feb 13 03:43:56 Mapping speed, Million of reads per hour | 9.18 Number of input reads | 3999815 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3195579 Uniquely mapped reads % | 79.89% Average mapped length | 51.76 Number of splices: Total | 297860 Number of splices: Annotated (sjdb) | 291095 Number of splices: GT/AG | 290505 Number of splices: GC/AG | 5240 Number of splices: AT/AC | 732 Number of splices: Non-canonical | 1383 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409150 % of reads mapped to multiple loci | 10.23% Number of reads mapped to too many loci | 282346 % of reads mapped to too many loci | 7.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 395086 395086 395086 N_multimapping 409150 409150 409150 N_noFeature 539428 3121656 604631 N_ambiguous 17920 140 9083 UnstrandedReadsAssigned:2638231 PositiveStrandReadsAssigned:73783 NegativeStrandReadsAssigned:2581865 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423374 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423374-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,815 reads, 3,039,181 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR5423374.ke.tsv 34699 SRR5423374.se.tsv 87100 total ==> SRR5423374.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 307 57.6831 Potri.005G024800.1.v4.1 1035 936 35 13.4827 Potri.004G059700.1.v4.1 961 862 3 1.25487 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 57.5257 7.29319 Potri.016G087400.1.v4.1 270 171 8 16.8686 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14.9463 3.21931 Potri.012G127500.1.v4.1 977 878 105 43.1201 ==> SRR5423374.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 38 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423374 completed mapping pipeline successfully