Starting /dee2/code/volunteer_pipeline.sh SRR5423375 current disk space = 3052001566720 free memory = 1582104164 SRR5423375 SRAfilesize 13b69da25f8592c200fa82ae94ce3635 SRR5423375.sra SRR5423375.sra file validated SRR5423375 is single end SRR5423375 is conventional basespace SRR5423375 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423375_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.226 34.0 31.0 34.0 30.0 34.0 2 32.327 34.0 31.0 34.0 30.0 34.0 3 32.4215 34.0 31.0 34.0 30.0 34.0 4 35.8165 37.0 35.0 37.0 35.0 37.0 5 35.85625 37.0 35.0 37.0 35.0 37.0 6 35.7995 37.0 35.0 37.0 35.0 37.0 7 35.83825 37.0 35.0 37.0 35.0 37.0 8 35.86625 37.0 35.0 37.0 35.0 37.0 9 37.4865 39.0 37.0 39.0 35.0 39.0 10 37.425 39.0 37.0 39.0 34.0 39.0 11 37.56625 39.0 37.0 39.0 35.0 39.0 12 37.51125 39.0 37.0 39.0 35.0 39.0 13 37.393 39.0 37.0 39.0 34.0 39.0 14 38.80425 40.0 38.0 41.0 35.0 41.0 15 38.66925 40.0 38.0 41.0 34.0 41.0 16 38.8035 40.0 38.0 41.0 34.0 41.0 17 38.83225 40.0 38.0 41.0 35.0 41.0 18 38.82975 40.0 38.0 41.0 35.0 41.0 19 38.82175 40.0 38.0 41.0 34.0 41.0 20 38.7555 40.0 38.0 41.0 34.0 41.0 21 38.705 40.0 38.0 41.0 34.0 41.0 22 38.67525 40.0 38.0 41.0 34.0 41.0 23 38.46175 40.0 38.0 41.0 34.0 41.0 24 38.5945 40.0 38.0 41.0 34.0 41.0 25 38.50975 40.0 38.0 41.0 34.0 41.0 26 38.385 40.0 38.0 41.0 34.0 41.0 27 38.4055 40.0 38.0 41.0 34.0 41.0 28 38.29625 40.0 38.0 41.0 33.0 41.0 29 38.19575 40.0 38.0 41.0 33.0 41.0 30 38.2195 40.0 38.0 41.0 33.0 41.0 31 38.1315 40.0 38.0 41.0 33.0 41.0 32 38.06425 40.0 38.0 41.0 33.0 41.0 33 38.1535 40.0 38.0 41.0 33.0 41.0 34 38.086 40.0 38.0 41.0 33.0 41.0 35 37.9875 40.0 38.0 41.0 33.0 41.0 36 37.85925 40.0 37.0 41.0 32.0 41.0 37 37.7145 40.0 37.0 41.0 32.0 41.0 38 37.81625 40.0 37.0 41.0 33.0 41.0 39 37.76225 40.0 37.0 41.0 32.0 41.0 40 37.6195 40.0 37.0 41.0 32.0 41.0 41 37.495 40.0 37.0 41.0 31.0 41.0 42 37.52225 40.0 37.0 41.0 31.0 41.0 43 37.4875 40.0 37.0 41.0 32.0 41.0 44 37.426 40.0 37.0 41.0 31.0 41.0 45 37.1865 40.0 36.0 41.0 31.0 41.0 46 37.21025 40.0 37.0 41.0 31.0 41.0 47 37.0495 40.0 36.0 41.0 31.0 41.0 48 36.743 39.0 36.0 41.0 30.0 41.0 49 36.78825 39.0 35.0 41.0 30.0 41.0 50 36.74675 39.0 35.0 41.0 30.0 41.0 51 36.478 39.0 35.0 41.0 30.0 41.0 52 35.01525 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1304 1 0.0 1304 2 0.0 1304 3 0.0 1304 4 0.0 1304 5 0.0 1304 6 0.0 1304 7 0.0 1304 8 0.0 1304 9 0.0 1304 10 0.0 1304 11 0.0 1304 12 0.0 1304 13 0.0 1304 14 0.0 1304 15 0.0 1304 16 0.0 1304 17 0.0 1304 18 0.0 1304 19 0.0 1304 20 0.0 1304 21 0.0 1304 22 0.0 1304 23 0.0 1304 24 0.0 1304 25 0.0 1304 26 0.0 1304 27 0.0 1304 28 0.0 1304 29 0.0 1304 30 0.0 1304 31 0.0 1304 32 0.0 1304 33 0.0 1304 34 0.0 1304 35 0.0 1304 36 0.0 1304 37 0.0 1304 38 0.0 1304 39 0.0 1304 40 0.0 1304 41 0.0 1304 42 0.0 1304 43 0.0 1304 44 0.0 1304 45 0.0 1304 46 0.0 1304 47 0.0 1304 48 0.0 1304 49 0.0 1304 50 0.0 1304 51 0.0 1304 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 3.0 22 5.0 23 9.0 24 11.0 25 17.0 26 13.0 27 28.0 28 29.0 29 37.0 30 56.0 31 81.0 32 92.0 33 123.0 34 149.0 35 237.0 36 310.0 37 425.0 38 724.0 39 1641.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.943971985992995 11.35567783891946 6.003001500750376 44.697348674337164 2 22.525000000000002 14.475 35.05 27.950000000000003 3 21.825 18.575 22.225 37.375 4 23.724999999999998 25.55 21.9 28.825 5 23.45 32.074999999999996 23.65 20.825 6 20.325 33.175 24.7 21.8 7 16.125 24.125 40.45 19.3 8 17.95 23.175 31.2 27.675 9 18.9 21.45 32.95 26.700000000000003 10 18.325 38.925 23.25 19.5 11 23.025000000000002 27.400000000000002 22.375 27.200000000000003 12 22.45 24.45 26.174999999999997 26.924999999999997 13 19.975 27.250000000000004 27.525 25.25 14 19.325 28.050000000000004 27.625 25.0 15 19.875 26.724999999999998 26.75 26.650000000000002 16 20.575 26.450000000000003 26.75 26.224999999999998 17 21.775 26.424999999999997 26.125 25.674999999999997 18 20.525 26.775 25.650000000000002 27.05 19 21.75 26.900000000000002 25.825 25.525 20 20.8 26.85 27.725 24.625 21 21.05 24.625 26.375 27.950000000000003 22 20.549999999999997 26.150000000000002 27.575 25.724999999999998 23 20.974999999999998 27.325 26.400000000000002 25.3 24 21.95 26.650000000000002 25.525 25.874999999999996 25 20.525 26.525 25.55 27.400000000000002 26 21.675 27.35 26.375 24.6 27 22.175 25.7 25.5 26.625 28 20.724999999999998 27.775 26.174999999999997 25.324999999999996 29 22.2 26.924999999999997 26.125 24.75 30 21.15 25.6 26.224999999999998 27.025 31 20.25 26.35 26.674999999999997 26.724999999999998 32 21.65 27.35 25.75 25.25 33 21.0 26.625 26.125 26.25 34 20.7 27.400000000000002 25.525 26.375 35 21.475 25.35 26.85 26.325 36 22.075 26.075 25.624999999999996 26.224999999999998 37 20.7 27.474999999999998 25.0 26.825 38 22.3 26.75 25.525 25.424999999999997 39 21.825 26.025 25.025 27.125 40 19.875 28.375 25.874999999999996 25.874999999999996 41 22.075 26.55 25.6 25.775 42 21.575 26.224999999999998 26.325 25.874999999999996 43 21.65 26.625 25.474999999999998 26.25 44 21.4 25.374999999999996 26.974999999999998 26.25 45 22.155538884721178 25.681420355088775 25.656414103525883 26.506626656664167 46 22.175 26.25 26.625 24.95 47 23.830957739434858 25.831457864466117 25.506376594148538 24.831207801950487 48 20.4 27.625 24.925 27.05 49 21.3 26.150000000000002 25.825 26.724999999999998 50 21.05 26.1 26.05 26.8 51 21.8 26.375 24.725 27.1 52 21.775 27.175 24.775 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 2.0 17 3.0 18 3.5 19 4.0 20 4.5 21 5.0 22 9.5 23 14.0 24 13.5 25 13.0 26 17.0 27 21.0 28 35.5 29 50.0 30 57.5 31 65.0 32 85.0 33 105.0 34 101.0 35 97.0 36 153.5 37 210.0 38 210.5 39 229.0 40 247.0 41 268.0 42 289.0 43 278.0 44 267.0 45 276.5 46 286.0 47 288.5 48 291.0 49 294.5 50 298.0 51 274.5 52 251.0 53 286.0 54 321.0 55 263.5 56 206.0 57 196.5 58 187.0 59 177.0 60 167.0 61 154.0 62 141.0 63 115.5 64 73.5 65 57.0 66 44.0 67 31.0 68 25.0 69 19.0 70 16.5 71 14.0 72 15.0 73 16.0 74 12.0 75 8.0 76 5.0 77 2.0 78 4.5 79 7.0 80 4.5 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.025 46 0.0 47 0.025 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.7 #Duplication Level Percentage of deduplicated Percentage of total 1 97.02194357366771 92.85 2 2.2988505747126435 4.3999999999999995 3 0.3396029258098223 0.975 4 0.13061650992685475 0.5 5 0.10449320794148381 0.5 6 0.052246603970741906 0.3 7 0.026123301985370953 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026123301985370953 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 12 0.3 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 6 0.15 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit GTACACACTAAGAAAAAAGCCTTATCCATTTACAAAAGTCTTATCCATTTGT 5 0.125 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra Read 200000 spots for SRR5423375.sra Written 200000 spots for SRR5423375.sra SRR ids: ['SRR5423375.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t8tpj6x7 SRR5423375.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423375 file size 703913 SRR5423375 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423375 SRR5423375_1.fastq Input file: SRR5423375_1.fastq trimmed: SRR5423375-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 03:33:35 2025 >> started Thu Feb 13 03:35:41 2025 >> done (126.399s) 4000000 reads processed; of these: 110 ( 0.00%) short reads filtered out after trimming by size control 87 ( 0.00%) empty reads filtered out after trimming by size control 3999803 (100.00%) reads available; of these: 87759 ( 2.19%) trimmed reads available after processing 3912044 (97.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 3 0.00% 25 3 0.00% 26 1 0.00% 27 5 0.00% 28 5 0.00% 29 3 0.00% 30 14 0.00% 31 16 0.00% 32 31 0.00% 33 25 0.00% 34 22 0.00% 35 25 0.00% 36 46 0.00% 37 39 0.00% 38 53 0.00% 39 67 0.00% 40 69 0.00% 41 100 0.00% 42 129 0.00% 43 165 0.00% 44 243 0.01% 45 299 0.01% 46 557 0.01% 47 858 0.02% 48 1523 0.04% 49 3606 0.09% 50 10108 0.25% 51 69735 1.74% 52 3912044 97.81% 3999803 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=27.40 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=1.1 sequence=AATCCTTTTAGTAAAAGATTGGGCCGAGTTTAATTTAATTGCAATTCAATTACGAGAATGAACATTAATTAGTGGATTACAACGTATCCATTGCTTGGAATTCAAATTTAATCTCCTTCCATACTTCACAAGCAGCAGCTAGTTCAGGGCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAGATCACGTCCCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGCACCGGGTGCATTTCCCCAAGGGTGCCCTAAAGTTCCTCCACCGAATTGTAGTACGGAATCATCTCCAAAGATCTCGGTCAGAGCAGGCATATGCCAAACGTGAATACCCCCCGAAGCCACGGGTAGAACACCCGGTAGAGAGACCCAATCTTGAGTGAAATAAATACCGCGGCTTCGATCTTTTTCAACAAAATCATCACGCAGTAAATCAACAAAACCCAAAGTTATGTCTCTTTCCCCTTCAAGTTTACCTAC Started job on | Feb 13 03:40:06 Started mapping on | Feb 13 03:40:08 Finished on | Feb 13 04:12:36 Mapping speed, Million of reads per hour | 7.39 Number of input reads | 3999803 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3194634 Uniquely mapped reads % | 79.87% Average mapped length | 51.77 Number of splices: Total | 297417 Number of splices: Annotated (sjdb) | 290819 Number of splices: GT/AG | 290013 Number of splices: GC/AG | 5318 Number of splices: AT/AC | 739 Number of splices: Non-canonical | 1347 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409228 % of reads mapped to multiple loci | 10.23% Number of reads mapped to too many loci | 285146 % of reads mapped to too many loci | 7.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 395941 395941 395941 N_multimapping 409228 409228 409228 N_noFeature 539384 3120861 604563 N_ambiguous 17702 128 8996 UnstrandedReadsAssigned:2637548 PositiveStrandReadsAssigned:73645 NegativeStrandReadsAssigned:2581075 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423375 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423375-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,803 reads, 3,042,737 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR5423375.ke.tsv 34699 SRR5423375.se.tsv 87100 total ==> SRR5423375.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 337 63.1641 Potri.005G024800.1.v4.1 1035 936 24 9.22255 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 64 8.09405 Potri.016G087400.1.v4.1 270 171 16 33.6542 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 12.8677 2.76479 Potri.012G127500.1.v4.1 977 878 121 49.5686 ==> SRR5423375.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 43 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423375 completed mapping pipeline successfully