Starting /dee2/code/volunteer_pipeline.sh SRR5423376 current disk space = 3051854798848 free memory = 1574576632 SRR5423376 SRAfilesize 403cb48b099595a8df15de580c251c1e SRR5423376.sra SRR5423376.sra file validated SRR5423376 is single end SRR5423376 is conventional basespace SRR5423376 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423376_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.02375 31.0 31.0 34.0 28.0 34.0 2 31.278 31.0 31.0 34.0 28.0 34.0 3 30.7405 31.0 30.0 34.0 27.0 34.0 4 33.741 35.0 33.0 37.0 28.0 37.0 5 34.704 35.0 35.0 37.0 30.0 37.0 6 34.717 35.0 35.0 37.0 32.0 37.0 7 34.95275 35.0 35.0 37.0 32.0 37.0 8 35.0105 36.0 35.0 37.0 32.0 37.0 9 36.699 39.0 35.0 39.0 32.0 39.0 10 36.44025 38.0 35.0 39.0 32.0 39.0 11 36.17275 38.0 35.0 39.0 30.0 39.0 12 36.6095 39.0 35.0 39.0 32.0 39.0 13 36.54475 39.0 35.0 39.0 32.0 39.0 14 37.30375 39.0 36.0 41.0 31.0 41.0 15 37.51075 39.0 36.0 41.0 32.0 41.0 16 37.5745 39.0 36.0 41.0 32.0 41.0 17 37.527 39.0 36.0 41.0 32.0 41.0 18 37.5575 39.0 36.0 41.0 32.0 41.0 19 37.84025 40.0 37.0 41.0 33.0 41.0 20 37.4995 39.0 36.0 41.0 32.0 41.0 21 37.52425 39.0 36.0 41.0 32.0 41.0 22 37.07575 39.0 36.0 40.0 31.0 41.0 23 37.32575 39.0 36.0 40.0 31.0 41.0 24 37.55625 39.0 36.0 41.0 32.0 41.0 25 37.503 39.0 36.0 41.0 32.0 41.0 26 37.0135 39.0 36.0 40.0 31.0 41.0 27 37.07425 39.0 36.0 40.0 31.0 41.0 28 37.1875 39.0 36.0 40.0 31.0 41.0 29 37.19825 39.0 36.0 40.0 31.0 41.0 30 37.22725 39.0 36.0 40.0 31.0 41.0 31 37.4025 39.0 36.0 40.0 31.0 41.0 32 36.9975 39.0 36.0 40.0 31.0 41.0 33 36.91525 39.0 36.0 40.0 30.0 41.0 34 37.05425 39.0 36.0 40.0 31.0 41.0 35 36.78475 39.0 36.0 40.0 30.0 41.0 36 36.919 39.0 35.0 40.0 30.0 41.0 37 37.07725 39.0 36.0 40.0 31.0 41.0 38 36.69875 39.0 35.0 40.0 30.0 41.0 39 36.87175 39.0 35.0 40.0 30.0 41.0 40 36.63075 39.0 35.0 40.0 30.0 41.0 41 36.63775 39.0 35.0 40.0 30.0 41.0 42 36.47225 39.0 35.0 40.0 30.0 41.0 43 36.37575 38.0 35.0 40.0 30.0 41.0 44 36.3175 38.0 35.0 40.0 30.0 41.0 45 36.04825 38.0 34.0 40.0 29.0 41.0 46 36.1495 38.0 35.0 40.0 29.0 41.0 47 36.09575 38.0 35.0 40.0 29.0 41.0 48 36.0535 38.0 34.0 40.0 28.0 41.0 49 36.14175 38.0 34.0 40.0 29.0 41.0 50 36.0945 38.0 34.0 40.0 29.0 41.0 51 35.644 38.0 34.0 40.0 28.0 41.0 52 35.2495 38.0 33.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1316 1 0.0 1316 2 0.0 1316 3 0.0 1316 4 0.0 1316 5 0.0 1316 6 0.0 1316 7 0.0 1316 8 0.0 1316 9 0.0 1316 10 0.0 1316 11 0.0 1316 12 0.0 1316 13 0.0 1316 14 0.0 1316 15 0.0 1316 16 0.0 1316 17 0.0 1316 18 0.0 1316 19 0.0 1316 20 0.0 1316 21 0.0 1316 22 0.0 1316 23 0.0 1316 24 0.0 1316 25 0.0 1316 26 0.0 1316 27 0.0 1316 28 0.0 1316 29 0.0 1316 30 0.0 1316 31 0.0 1316 32 0.0 1316 33 0.0 1316 34 0.0 1316 35 0.0 1316 36 0.0 1316 37 0.0 1316 38 0.0 1316 39 0.0 1316 40 0.0 1316 41 0.0 1316 42 0.0 1316 43 0.0 1316 44 0.0 1316 45 0.0 1316 46 0.0 1316 47 0.0 1316 48 0.0 1316 49 0.0 1316 50 0.0 1316 51 0.0 1316 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 4.0 23 7.0 24 9.0 25 15.0 26 23.0 27 43.0 28 57.0 29 75.0 30 103.0 31 104.0 32 209.0 33 209.0 34 287.0 35 293.0 36 425.0 37 550.0 38 689.0 39 894.0 40 3.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.925000000000004 12.325 6.625 44.125 2 22.625 16.225 33.675 27.474999999999998 3 20.775 18.875 23.9 36.449999999999996 4 25.900000000000002 26.224999999999998 21.475 26.400000000000002 5 23.974999999999998 30.475 24.15 21.4 6 20.200000000000003 32.775 23.75 23.275000000000002 7 15.625 23.724999999999998 41.925000000000004 18.725 8 17.474999999999998 23.825 31.874999999999996 26.825 9 19.5 21.099999999999998 33.7 25.7 10 18.45 37.974999999999994 23.9 19.675 11 21.85 29.775000000000002 22.05 26.325 12 21.349999999999998 24.5 27.575 26.575 13 20.025000000000002 26.950000000000003 27.875 25.15 14 19.475 27.3 28.999999999999996 24.224999999999998 15 20.325 26.325 27.85 25.5 16 21.375 26.5 25.25 26.875 17 20.775 27.425 26.775 25.025 18 20.575 26.924999999999997 26.150000000000002 26.35 19 21.575 26.55 24.9 26.974999999999998 20 21.2 26.1 27.400000000000002 25.3 21 21.075 25.775 26.6 26.55 22 21.125 27.55 25.374999999999996 25.95 23 22.325 26.625 24.95 26.1 24 20.875 27.3 26.125 25.7 25 21.575 25.650000000000002 25.424999999999997 27.35 26 20.849999999999998 27.125 26.900000000000002 25.124999999999996 27 21.825 26.450000000000003 26.625 25.1 28 21.475 26.85 26.224999999999998 25.45 29 20.549999999999997 27.175 28.1 24.175 30 23.875 25.7 26.150000000000002 24.275 31 20.1 26.525 27.375 26.0 32 21.55 27.150000000000002 26.900000000000002 24.4 33 21.15 27.400000000000002 26.075 25.374999999999996 34 20.8 27.975 24.875 26.35 35 21.099999999999998 25.525 26.950000000000003 26.424999999999997 36 20.925 26.25 25.424999999999997 27.400000000000002 37 20.674999999999997 25.900000000000002 26.825 26.6 38 21.475 27.200000000000003 25.324999999999996 26.0 39 21.6 25.5 25.95 26.950000000000003 40 21.275 27.325 24.95 26.450000000000003 41 22.075 27.200000000000003 25.124999999999996 25.6 42 22.25 25.924999999999997 25.45 26.375 43 22.05 27.075 25.525 25.35 44 22.35 27.1 26.075 24.474999999999998 45 21.75 24.425 26.625 27.200000000000003 46 21.5 26.775 25.324999999999996 26.400000000000002 47 21.575 26.974999999999998 26.075 25.374999999999996 48 22.2 27.575 24.6 25.624999999999996 49 21.349999999999998 26.950000000000003 25.124999999999996 26.575 50 21.65 27.125 24.525 26.700000000000003 51 22.0 26.05 25.275 26.674999999999997 52 21.85 25.575 24.675 27.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 2.0 5 1.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 2.5 17 4.0 18 6.5 19 9.0 20 8.5 21 8.0 22 10.5 23 13.0 24 17.5 25 22.0 26 27.0 27 32.0 28 42.5 29 53.0 30 68.5 31 84.0 32 95.5 33 107.0 34 109.5 35 112.0 36 147.0 37 182.0 38 210.0 39 230.5 40 223.0 41 247.5 42 272.0 43 272.5 44 273.0 45 268.0 46 263.0 47 286.5 48 310.0 49 311.5 50 313.0 51 284.5 52 256.0 53 275.5 54 295.0 55 244.5 56 194.0 57 179.0 58 164.0 59 173.0 60 182.0 61 149.5 62 117.0 63 92.5 64 63.5 65 59.0 66 45.5 67 32.0 68 29.0 69 26.0 70 23.0 71 20.0 72 25.0 73 30.0 74 21.5 75 13.0 76 10.5 77 8.0 78 8.0 79 8.0 80 5.0 81 2.0 82 1.5 83 1.0 84 1.0 85 1.0 86 1.5 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 96.91099476439791 92.55 2 2.408376963350785 4.6 3 0.36649214659685864 1.05 4 0.10471204188481677 0.4 5 0.026178010471204192 0.125 6 0.07853403141361257 0.44999999999999996 7 0.052356020942408384 0.35000000000000003 8 0.0 0.0 9 0.026178010471204192 0.22499999999999998 >10 0.026178010471204192 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 10 0.25 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 9 0.22499999999999998 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 7 0.17500000000000002 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 6 0.15 No Hit GTGCATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGTA 6 0.15 No Hit CCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGG 6 0.15 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra Read 200000 spots for SRR5423376.sra Written 200000 spots for SRR5423376.sra SRR ids: ['SRR5423376.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9ejvefa6 SRR5423376.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423376 file size 703988 SRR5423376 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423376 SRR5423376_1.fastq Input file: SRR5423376_1.fastq trimmed: SRR5423376-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 04:12:10 2025 >> started Thu Feb 13 04:17:08 2025 >> done (297.738s) 4000000 reads processed; of these: 112 ( 0.00%) short reads filtered out after trimming by size control 79 ( 0.00%) empty reads filtered out after trimming by size control 3999809 (100.00%) reads available; of these: 126462 ( 3.16%) trimmed reads available after processing 3873347 (96.84%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 5 0.00% 21 0 0.00% 22 0 0.00% 23 5 0.00% 24 3 0.00% 25 6 0.00% 26 9 0.00% 27 10 0.00% 28 22 0.00% 29 23 0.00% 30 33 0.00% 31 43 0.00% 32 67 0.00% 33 58 0.00% 34 46 0.00% 35 65 0.00% 36 77 0.00% 37 85 0.00% 38 110 0.00% 39 136 0.00% 40 183 0.00% 41 225 0.01% 42 277 0.01% 43 409 0.01% 44 472 0.01% 45 799 0.02% 46 1025 0.03% 47 1753 0.04% 48 3153 0.08% 49 6262 0.16% 50 16176 0.40% 51 94920 2.37% 52 3873347 96.84% 3999809 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=24 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=13.62 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.7 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGG Started job on | Feb 13 04:20:00 Started mapping on | Feb 13 04:20:09 Finished on | Feb 13 04:33:34 Mapping speed, Million of reads per hour | 17.89 Number of input reads | 3999809 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3201870 Uniquely mapped reads % | 80.05% Average mapped length | 51.75 Number of splices: Total | 297817 Number of splices: Annotated (sjdb) | 291145 Number of splices: GT/AG | 290486 Number of splices: GC/AG | 5252 Number of splices: AT/AC | 720 Number of splices: Non-canonical | 1359 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410349 % of reads mapped to multiple loci | 10.26% Number of reads mapped to too many loci | 273207 % of reads mapped to too many loci | 6.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 387590 387590 387590 N_multimapping 410349 410349 410349 N_noFeature 538494 3127634 604044 N_ambiguous 17828 116 9039 UnstrandedReadsAssigned:2645548 PositiveStrandReadsAssigned:74120 NegativeStrandReadsAssigned:2588787 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423376 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423376-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,809 reads, 3,031,791 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR5423376.ke.tsv 34699 SRR5423376.se.tsv 87100 total ==> SRR5423376.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 308 58.0431 Potri.005G024800.1.v4.1 1035 936 29 11.2046 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 72.1619 9.176 Potri.016G087400.1.v4.1 270 171 9 19.0336 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 13 2.80843 Potri.012G127500.1.v4.1 977 878 111 45.7197 ==> SRR5423376.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 39 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423376 completed mapping pipeline successfully