Starting /dee2/code/volunteer_pipeline.sh SRR5423377 current disk space = 3051816189952 free memory = 1578966012 SRR5423377 SRAfilesize 2c5d7844cb11af8e4afa2e8369ba2d51 SRR5423377.sra SRR5423377.sra file validated SRR5423377 is single end SRR5423377 is conventional basespace SRR5423377 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423377_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.42075 31.0 30.0 33.0 25.0 34.0 2 31.16175 31.0 31.0 34.0 28.0 34.0 3 31.51825 31.0 31.0 34.0 30.0 34.0 4 28.21075 32.0 19.0 35.0 10.0 37.0 5 33.041 35.0 32.0 37.0 28.0 37.0 6 34.53625 35.0 35.0 37.0 31.0 37.0 7 34.9815 35.0 35.0 37.0 32.0 37.0 8 35.1275 36.0 35.0 37.0 32.0 37.0 9 36.82275 39.0 37.0 39.0 33.0 39.0 10 36.748 39.0 37.0 39.0 32.0 39.0 11 36.9615 39.0 37.0 39.0 33.0 39.0 12 37.02225 39.0 37.0 39.0 33.0 39.0 13 36.9755 39.0 37.0 39.0 33.0 39.0 14 38.033 40.0 37.0 41.0 33.0 41.0 15 37.88825 40.0 37.0 41.0 33.0 41.0 16 37.96525 40.0 37.0 41.0 33.0 41.0 17 37.866 40.0 37.0 41.0 33.0 41.0 18 38.0265 40.0 37.0 41.0 33.0 41.0 19 38.06125 40.0 37.0 41.0 33.0 41.0 20 37.89625 40.0 37.0 41.0 33.0 41.0 21 37.99925 40.0 37.0 41.0 33.0 41.0 22 37.6535 40.0 37.0 41.0 32.0 41.0 23 37.5885 39.0 37.0 41.0 32.0 41.0 24 37.569 40.0 37.0 41.0 32.0 41.0 25 37.81175 40.0 37.0 41.0 33.0 41.0 26 37.68625 40.0 37.0 41.0 32.0 41.0 27 37.45525 40.0 37.0 41.0 31.0 41.0 28 37.589 40.0 37.0 41.0 32.0 41.0 29 37.595 39.0 37.0 41.0 32.0 41.0 30 37.59875 40.0 37.0 41.0 32.0 41.0 31 37.543 40.0 36.0 41.0 32.0 41.0 32 37.473 40.0 37.0 41.0 32.0 41.0 33 37.0205 39.0 36.0 41.0 30.0 41.0 34 37.24225 39.0 36.0 41.0 31.0 41.0 35 37.2305 39.0 36.0 41.0 31.0 41.0 36 37.14375 39.0 36.0 41.0 31.0 41.0 37 37.0745 39.0 36.0 41.0 31.0 41.0 38 37.014 39.0 36.0 40.0 30.0 41.0 39 37.05925 39.0 36.0 41.0 30.0 41.0 40 36.973 39.0 36.0 40.0 30.0 41.0 41 36.66625 39.0 35.0 40.0 30.0 41.0 42 36.71225 39.0 35.0 40.0 30.0 41.0 43 36.78475 39.0 35.0 40.0 30.0 41.0 44 36.33675 39.0 35.0 40.0 29.0 41.0 45 36.44125 39.0 35.0 40.0 30.0 41.0 46 36.5455 39.0 35.0 40.0 30.0 41.0 47 36.32425 39.0 35.0 40.0 29.0 41.0 48 36.342 38.0 35.0 40.0 29.0 41.0 49 36.2525 38.0 35.0 40.0 30.0 41.0 50 36.27275 39.0 35.0 40.0 29.0 41.0 51 36.28975 38.0 35.0 40.0 29.0 41.0 52 34.949 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2111 1 0.0 2111 2 0.0 2111 3 0.0 2111 4 0.0 2111 5 0.0 2111 6 0.0 2111 7 0.0 2111 8 0.0 2111 9 0.0 2111 10 0.0 2111 11 0.0 2111 12 0.0 2111 13 0.0 2111 14 0.0 2111 15 0.0 2111 16 0.0 2111 17 0.0 2111 18 0.0 2111 19 0.0 2111 20 0.0 2111 21 0.0 2111 22 0.0 2111 23 0.0 2111 24 0.0 2111 25 0.0 2111 26 0.0 2111 27 0.0 2111 28 0.0 2111 29 0.0 2111 30 0.0 2111 31 0.0 2111 32 0.0 2111 33 0.0 2111 34 0.0 2111 35 0.0 2111 36 0.0 2111 37 0.0 2111 38 0.0 2111 39 0.0 2111 40 0.0 2111 41 0.0 2111 42 0.0 2111 43 0.0 2111 44 0.0 2111 45 0.0 2111 46 0.0 2111 47 0.0 2111 48 0.0 2111 49 0.0 2111 50 0.0 2111 51 0.0 2111 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 6.0 22 6.0 23 8.0 24 11.0 25 23.0 26 21.0 27 30.0 28 46.0 29 64.0 30 88.0 31 112.0 32 159.0 33 200.0 34 231.0 35 314.0 36 417.0 37 561.0 38 870.0 39 827.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.310310310310314 13.188188188188189 7.057057057057057 44.44444444444444 2 22.95 14.649999999999999 34.8 27.6 3 21.325 17.849999999999998 24.325 36.5 4 25.7 24.8 23.775 25.724999999999998 5 23.799999999999997 31.85 23.3 21.05 6 19.650000000000002 33.375 23.875 23.1 7 14.099999999999998 23.525 42.1 20.275000000000002 8 17.75 22.45 32.0 27.800000000000004 9 17.724999999999998 21.4 33.050000000000004 27.825 10 18.025 37.1 24.75 20.125 11 22.95 27.675 21.8 27.575 12 21.175 24.6 27.700000000000003 26.525 13 19.0 26.900000000000002 29.45 24.65 14 20.9 27.0 27.1 25.0 15 21.475 27.125 25.85 25.55 16 20.200000000000003 27.05 25.7 27.05 17 19.875 28.275 26.150000000000002 25.7 18 20.1 27.025 25.674999999999997 27.200000000000003 19 22.1 27.250000000000004 24.325 26.325 20 20.025000000000002 28.025 27.35 24.6 21 20.200000000000003 26.150000000000002 26.674999999999997 26.974999999999998 22 20.9 27.875 25.650000000000002 25.575 23 20.150000000000002 28.050000000000004 24.925 26.875 24 21.175 26.474999999999998 25.624999999999996 26.724999999999998 25 21.6 26.775 25.974999999999998 25.650000000000002 26 21.375 26.525 26.825 25.275 27 20.724999999999998 26.974999999999998 25.825 26.474999999999998 28 20.424999999999997 27.800000000000004 27.85 23.925 29 21.175 27.500000000000004 26.25 25.074999999999996 30 20.875 27.950000000000003 26.275 24.9 31 21.375 28.249999999999996 25.624999999999996 24.75 32 21.775 26.825 26.25 25.15 33 21.025 27.525 25.924999999999997 25.525 34 20.325 26.424999999999997 28.050000000000004 25.2 35 20.95 26.1 26.6 26.35 36 20.599999999999998 26.724999999999998 26.5 26.174999999999997 37 20.849999999999998 26.224999999999998 26.075 26.85 38 22.275 26.674999999999997 25.1 25.95 39 21.349999999999998 26.55 25.224999999999998 26.875 40 21.2 26.525 26.375 25.900000000000002 41 20.8 26.875 26.174999999999997 26.150000000000002 42 21.9 26.900000000000002 25.674999999999997 25.525 43 20.75 27.275 26.025 25.95 44 20.775 27.650000000000002 26.25 25.324999999999996 45 21.55 26.8 25.4 26.25 46 21.25 26.825 25.3 26.625 47 21.675 27.575 24.474999999999998 26.275 48 22.05 25.624999999999996 25.35 26.974999999999998 49 21.575 26.525 25.0 26.900000000000002 50 21.275 27.075 26.825 24.825 51 21.875 26.8 24.275 27.05 52 22.45 26.924999999999997 24.175 26.450000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 2.5 15 4.0 16 3.5 17 3.0 18 5.5 19 8.0 20 9.5 21 11.0 22 15.5 23 20.0 24 17.0 25 14.0 26 23.5 27 33.0 28 43.0 29 53.0 30 65.5 31 78.0 32 80.0 33 82.0 34 106.5 35 131.0 36 157.5 37 184.0 38 216.0 39 243.0 40 238.0 41 253.0 42 268.0 43 281.0 44 294.0 45 290.5 46 287.0 47 278.5 48 270.0 49 288.0 50 306.0 51 284.0 52 262.0 53 266.0 54 270.0 55 242.0 56 214.0 57 199.5 58 185.0 59 174.5 60 164.0 61 148.0 62 132.0 63 102.0 64 64.5 65 57.0 66 46.5 67 36.0 68 27.5 69 19.0 70 17.5 71 16.0 72 17.0 73 18.0 74 12.5 75 7.0 76 6.0 77 5.0 78 5.5 79 6.0 80 3.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.6 #Duplication Level Percentage of deduplicated Percentage of total 1 97.74844720496894 94.425 2 1.7080745341614907 3.3000000000000003 3 0.2587991718426501 0.75 4 0.10351966873706005 0.4 5 0.07763975155279502 0.375 6 0.025879917184265012 0.15 7 0.0 0.0 8 0.07763975155279502 0.6 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 8 0.2 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 8 0.2 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 8 0.2 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 5 0.125 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra Read 200000 spots for SRR5423377.sra Written 200000 spots for SRR5423377.sra SRR ids: ['SRR5423377.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jy5mdvvn SRR5423377.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423377 file size 703994 SRR5423377 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423377 SRR5423377_1.fastq Input file: SRR5423377_1.fastq trimmed: SRR5423377-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 04:19:25 2025 >> started Thu Feb 13 04:20:37 2025 >> done (71.940s) 4000000 reads processed; of these: 105 ( 0.00%) short reads filtered out after trimming by size control 82 ( 0.00%) empty reads filtered out after trimming by size control 3999813 (100.00%) reads available; of these: 157401 ( 3.94%) trimmed reads available after processing 3842412 (96.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 5 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 5 0.00% 25 11 0.00% 26 10 0.00% 27 14 0.00% 28 24 0.00% 29 22 0.00% 30 28 0.00% 31 39 0.00% 32 68 0.00% 33 61 0.00% 34 49 0.00% 35 80 0.00% 36 65 0.00% 37 111 0.00% 38 120 0.00% 39 146 0.00% 40 167 0.00% 41 209 0.01% 42 268 0.01% 43 384 0.01% 44 602 0.02% 45 749 0.02% 46 1107 0.03% 47 1830 0.05% 48 3214 0.08% 49 6510 0.16% 50 18150 0.45% 51 123341 3.08% 52 3842412 96.06% 3999813 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.21 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=18.66 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.0 sequence=GGGCCGAGTTTAATTTAATTGCAATTCAATTACGAGAATGAACATTAATTAGTGGATTACAACGTATCCATTGCTTGGAATTCAAATTTAATCTCCTTCCATACTTCACAAGCAGCAGCTAGTTCAGGGCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAGATCACGTCCCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGCACCGGGTGCATTTCCCCAAGGGTGCCCTAAAGTTCCTCCACCGAATTGTAGTACGGAATCATCTCCAAAGATCTCGGTCAGAGCAGGCATATGCCAAACGTGAATACCCCCCGAAGCCACGGGTAGAACACCCGGTAGAGAGACCCAATCTTGAGTGAAATAAATACCGCGGCTTCGATCTTTTTCAACAAAATCATCACGCAGTAAATCAACAAAACCCAAAGTTATGTCTCTTTCCCCTTCAAGTTTACCTACTACGGTACCAGAGTGAATAT Started job on | Feb 13 04:25:29 Started mapping on | Feb 13 04:25:32 Finished on | Feb 13 05:01:40 Mapping speed, Million of reads per hour | 6.64 Number of input reads | 3999813 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3192223 Uniquely mapped reads % | 79.81% Average mapped length | 51.73 Number of splices: Total | 295384 Number of splices: Annotated (sjdb) | 288592 Number of splices: GT/AG | 288111 Number of splices: GC/AG | 5271 Number of splices: AT/AC | 700 Number of splices: Non-canonical | 1302 Mismatch rate per base, % | 0.64% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410838 % of reads mapped to multiple loci | 10.27% Number of reads mapped to too many loci | 272240 % of reads mapped to too many loci | 6.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 396752 396752 396752 N_multimapping 410838 410838 410838 N_noFeature 538012 3118795 602711 N_ambiguous 17847 106 9031 UnstrandedReadsAssigned:2636364 PositiveStrandReadsAssigned:73322 NegativeStrandReadsAssigned:2580481 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423377 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423377-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,813 reads, 2,939,427 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR5423377.ke.tsv 34699 SRR5423377.se.tsv 87100 total ==> SRR5423377.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 349.806 67.9469 Potri.005G024800.1.v4.1 1035 936 26.0746 10.3839 Potri.004G059700.1.v4.1 961 862 2 0.864849 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 81.0879 10.6278 Potri.016G087400.1.v4.1 270 171 15 32.6974 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 9.73962 2.16872 Potri.012G127500.1.v4.1 977 878 101 42.879 ==> SRR5423377.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 24 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423377 completed mapping pipeline successfully