Starting /dee2/code/volunteer_pipeline.sh SRR5423378 current disk space = 3051725643776 free memory = 1572762040 SRR5423378 SRAfilesize 98e551edbca2ef98290d62589ee2b4f9 SRR5423378.sra SRR5423378.sra file validated SRR5423378 is single end SRR5423378 is conventional basespace SRR5423378 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423378_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.19975 34.0 31.0 34.0 30.0 34.0 2 32.27075 34.0 31.0 34.0 30.0 34.0 3 32.309 34.0 31.0 34.0 30.0 34.0 4 35.73375 37.0 35.0 37.0 33.0 37.0 5 35.661 37.0 35.0 37.0 33.0 37.0 6 35.751 37.0 35.0 37.0 33.0 37.0 7 35.7575 37.0 35.0 37.0 35.0 37.0 8 35.828 37.0 35.0 37.0 35.0 37.0 9 37.49225 39.0 37.0 39.0 35.0 39.0 10 37.423 39.0 37.0 39.0 34.0 39.0 11 37.40825 39.0 37.0 39.0 34.0 39.0 12 37.47025 39.0 37.0 39.0 35.0 39.0 13 37.3585 39.0 37.0 39.0 34.0 39.0 14 38.70825 40.0 38.0 41.0 34.0 41.0 15 38.82225 40.0 38.0 41.0 35.0 41.0 16 38.69625 40.0 38.0 41.0 34.0 41.0 17 38.6685 40.0 38.0 41.0 34.0 41.0 18 38.70125 40.0 38.0 41.0 35.0 41.0 19 38.76275 40.0 38.0 41.0 34.0 41.0 20 38.6945 40.0 38.0 41.0 34.0 41.0 21 38.66275 40.0 38.0 41.0 34.0 41.0 22 38.603 40.0 38.0 41.0 34.0 41.0 23 38.66875 40.0 38.0 41.0 34.0 41.0 24 38.44725 40.0 38.0 41.0 34.0 41.0 25 38.10825 40.0 38.0 41.0 33.0 41.0 26 38.135 40.0 38.0 41.0 33.0 41.0 27 38.23375 40.0 38.0 41.0 33.0 41.0 28 38.25275 40.0 38.0 41.0 34.0 41.0 29 38.05125 40.0 38.0 41.0 33.0 41.0 30 38.11575 40.0 38.0 41.0 33.0 41.0 31 38.00975 40.0 38.0 41.0 33.0 41.0 32 37.8975 40.0 38.0 41.0 32.0 41.0 33 37.83375 40.0 37.0 41.0 33.0 41.0 34 37.9455 40.0 38.0 41.0 33.0 41.0 35 37.63825 40.0 37.0 41.0 32.0 41.0 36 37.6635 40.0 37.0 41.0 32.0 41.0 37 37.759 40.0 37.0 41.0 32.0 41.0 38 37.6475 40.0 37.0 41.0 33.0 41.0 39 37.7855 40.0 37.0 41.0 33.0 41.0 40 37.619 40.0 37.0 41.0 32.0 41.0 41 37.50125 40.0 37.0 41.0 31.0 41.0 42 37.4745 40.0 37.0 41.0 32.0 41.0 43 37.19775 40.0 36.0 41.0 31.0 41.0 44 37.207 40.0 36.0 41.0 31.0 41.0 45 37.204 39.0 36.0 41.0 31.0 41.0 46 37.12125 40.0 36.0 41.0 31.0 41.0 47 37.17275 40.0 36.0 41.0 31.0 41.0 48 37.02675 39.0 36.0 41.0 30.0 41.0 49 37.0255 39.0 36.0 41.0 31.0 41.0 50 36.68025 39.0 35.0 41.0 30.0 41.0 51 36.54075 39.0 35.0 41.0 30.0 41.0 52 35.23225 38.0 34.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2208 1 0.0 2208 2 0.0 2208 3 0.0 2208 4 0.0 2208 5 0.0 2208 6 0.0 2208 7 0.0 2208 8 0.0 2208 9 0.0 2208 10 0.0 2208 11 0.0 2208 12 0.0 2208 13 0.0 2208 14 0.0 2208 15 0.0 2208 16 0.0 2208 17 0.0 2208 18 0.0 2208 19 0.0 2208 20 0.0 2208 21 0.0 2208 22 0.0 2208 23 0.0 2208 24 0.0 2208 25 0.0 2208 26 0.0 2208 27 0.0 2208 28 0.0 2208 29 0.0 2208 30 0.0 2208 31 0.0 2208 32 0.0 2208 33 0.0 2208 34 0.0 2208 35 0.0 2208 36 0.0 2208 37 0.0 2208 38 0.0 2208 39 0.0 2208 40 0.0 2208 41 0.0 2208 42 0.0 2208 43 0.0 2208 44 0.0 2208 45 0.0 2208 46 0.0 2208 47 0.0 2208 48 0.0 2208 49 0.0 2208 50 0.0 2208 51 0.0 2208 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 2.0 22 5.0 23 7.0 24 10.0 25 18.0 26 18.0 27 31.0 28 23.0 29 53.0 30 60.0 31 82.0 32 90.0 33 132.0 34 187.0 35 204.0 36 292.0 37 453.0 38 737.0 39 1589.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.91291291291291 11.786786786786786 6.156156156156156 44.14414414414414 2 22.575 13.975000000000001 35.65 27.800000000000004 3 21.8 17.349999999999998 23.9 36.95 4 24.65 26.825 22.3 26.224999999999998 5 24.05 31.2 22.45 22.3 6 19.125 33.85 24.7 22.325 7 15.2 23.375 42.425000000000004 19.0 8 18.099999999999998 23.625 31.0 27.275 9 19.125 20.875 33.550000000000004 26.450000000000003 10 17.525 38.175 24.2 20.1 11 23.375 27.224999999999998 22.225 27.175 12 21.375 25.224999999999998 27.175 26.224999999999998 13 20.925 26.650000000000002 27.525 24.9 14 19.75 27.775 27.400000000000002 25.074999999999996 15 21.5 27.3 26.474999999999998 24.725 16 20.7 26.75 25.85 26.700000000000003 17 20.95 27.224999999999998 25.874999999999996 25.95 18 20.025000000000002 27.0 25.974999999999998 27.0 19 22.225 26.650000000000002 24.875 26.25 20 21.675 26.650000000000002 26.525 25.15 21 21.9 26.525 25.650000000000002 25.924999999999997 22 22.125 28.349999999999998 23.9 25.624999999999996 23 22.225 26.375 25.4 26.0 24 21.325 26.775 25.775 26.125 25 21.375 25.874999999999996 25.575 27.175 26 22.175 26.674999999999997 25.674999999999997 25.474999999999998 27 21.099999999999998 27.125 26.625 25.15 28 21.175 26.875 26.125 25.825 29 21.575 26.875 26.424999999999997 25.124999999999996 30 21.099999999999998 25.8 27.250000000000004 25.85 31 22.5 26.0 25.624999999999996 25.874999999999996 32 21.85 25.05 27.3 25.8 33 20.65 26.974999999999998 24.7 27.675 34 21.125 28.000000000000004 25.174999999999997 25.7 35 20.65 26.5 26.575 26.275 36 20.974999999999998 25.825 25.924999999999997 27.275 37 20.65 25.525 27.425 26.400000000000002 38 20.674999999999997 27.35 25.825 26.150000000000002 39 21.25 25.95 25.924999999999997 26.875 40 20.775 26.875 27.35 25.0 41 21.224999999999998 26.900000000000002 25.374999999999996 26.5 42 21.275 27.275 24.65 26.8 43 21.675 27.025 26.05 25.25 44 21.5 27.55 25.074999999999996 25.874999999999996 45 22.8 27.375 24.525 25.3 46 22.1 24.775 26.3 26.825 47 20.775 26.924999999999997 24.349999999999998 27.950000000000003 48 22.275 26.5 25.124999999999996 26.1 49 21.925 26.55 25.275 26.25 50 22.05 26.075 26.174999999999997 25.7 51 21.3 25.900000000000002 26.1 26.700000000000003 52 21.349999999999998 27.325 24.325 27.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 2.0 3 1.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.5 14 1.5 15 1.0 16 2.0 17 3.0 18 5.0 19 7.0 20 6.5 21 6.0 22 9.0 23 12.0 24 16.0 25 20.0 26 25.5 27 31.0 28 34.0 29 37.0 30 46.5 31 56.0 32 72.0 33 88.0 34 110.5 35 133.0 36 160.0 37 187.0 38 199.5 39 231.0 40 250.0 41 261.0 42 272.0 43 268.5 44 265.0 45 268.0 46 271.0 47 288.0 48 305.0 49 307.0 50 309.0 51 301.0 52 293.0 53 292.0 54 291.0 55 251.0 56 211.0 57 209.5 58 208.0 59 181.0 60 154.0 61 134.5 62 115.0 63 93.0 64 62.5 65 54.0 66 48.5 67 43.0 68 36.0 69 29.0 70 23.0 71 17.0 72 18.0 73 19.0 74 15.0 75 11.0 76 8.0 77 5.0 78 6.5 79 8.0 80 4.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.125 #Duplication Level Percentage of deduplicated Percentage of total 1 96.95137976346912 92.225 2 2.2076215505913273 4.2 3 0.5256241787122208 1.5 4 0.10512483574244415 0.4 5 0.07884362680683311 0.375 6 0.026281208935611037 0.15 7 0.052562417871222074 0.35000000000000003 8 0.0 0.0 9 0.026281208935611037 0.22499999999999998 >10 0.026281208935611037 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 23 0.575 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 9 0.22499999999999998 No Hit CCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATC 7 0.17500000000000002 No Hit CCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGA 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 6 0.15 No Hit GTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCA 5 0.125 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit GTGATCGTCTCTGAGGAGCTCATGTCAGGGTACATCTTGCATCCTCCACAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra Read 200000 spots for SRR5423378.sra Written 200000 spots for SRR5423378.sra SRR ids: ['SRR5423378.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0x6vuq0r SRR5423378.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423378 file size 703953 SRR5423378 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423378 SRR5423378_1.fastq Input file: SRR5423378_1.fastq trimmed: SRR5423378-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 04:31:14 2025 >> started Thu Feb 13 04:35:38 2025 >> done (263.783s) 4000000 reads processed; of these: 106 ( 0.00%) short reads filtered out after trimming by size control 64 ( 0.00%) empty reads filtered out after trimming by size control 3999830 (100.00%) reads available; of these: 110646 ( 2.77%) trimmed reads available after processing 3889184 (97.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 7 0.00% 26 7 0.00% 27 8 0.00% 28 15 0.00% 29 13 0.00% 30 20 0.00% 31 24 0.00% 32 37 0.00% 33 53 0.00% 34 44 0.00% 35 55 0.00% 36 61 0.00% 37 90 0.00% 38 86 0.00% 39 110 0.00% 40 127 0.00% 41 117 0.00% 42 188 0.00% 43 286 0.01% 44 427 0.01% 45 573 0.01% 46 878 0.02% 47 1440 0.04% 48 2681 0.07% 49 5368 0.13% 50 14156 0.35% 51 83756 2.09% 52 3889184 97.23% 3999830 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=12.03 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=1.2 sequence=CCGCACTTGCACTTGCCATCGTTCTCGGTTGCTGGAACCTCCATGACTCCAGTGTAGACATGGCTCTTCTCAGTCTCAACGATGTCAGCAGTGTAGCTGCTTCCCTTCTTGAC Started job on | Feb 13 04:55:11 Started mapping on | Feb 13 04:55:15 Finished on | Feb 13 05:55:12 Mapping speed, Million of reads per hour | 4.00 Number of input reads | 3999830 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3200252 Uniquely mapped reads % | 80.01% Average mapped length | 51.76 Number of splices: Total | 298300 Number of splices: Annotated (sjdb) | 291590 Number of splices: GT/AG | 290842 Number of splices: GC/AG | 5341 Number of splices: AT/AC | 702 Number of splices: Non-canonical | 1415 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409169 % of reads mapped to multiple loci | 10.23% Number of reads mapped to too many loci | 277119 % of reads mapped to too many loci | 6.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 390409 390409 390409 N_multimapping 409169 409169 409169 N_noFeature 540899 3126693 605731 N_ambiguous 18004 102 9202 UnstrandedReadsAssigned:2641349 PositiveStrandReadsAssigned:73457 NegativeStrandReadsAssigned:2585319 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423378 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423378-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,830 reads, 3,030,631 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR5423378.ke.tsv 34699 SRR5423378.se.tsv 87100 total ==> SRR5423378.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 330 62.3025 Potri.005G024800.1.v4.1 1035 936 38 14.7087 Potri.004G059700.1.v4.1 961 862 1 0.4203 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 90.3422 11.5087 Potri.016G087400.1.v4.1 270 171 9 19.0684 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20.9202 4.5277 Potri.012G127500.1.v4.1 977 878 128 52.818 ==> SRR5423378.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 33 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423378 completed mapping pipeline successfully