Starting /dee2/code/volunteer_pipeline.sh SRR5423379 current disk space = 3051711115264 free memory = 1577818856 SRR5423379 SRAfilesize b1f0deea5ded6b2b46c2b67760b9370d SRR5423379.sra SRR5423379.sra file validated SRR5423379 is single end SRR5423379 is conventional basespace SRR5423379 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423379_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3355 34.0 31.0 34.0 30.0 34.0 2 32.45325 34.0 31.0 34.0 30.0 34.0 3 32.54125 34.0 31.0 34.0 30.0 34.0 4 35.92375 37.0 35.0 37.0 35.0 37.0 5 35.8755 37.0 35.0 37.0 35.0 37.0 6 35.8165 37.0 35.0 37.0 35.0 37.0 7 35.87225 37.0 35.0 37.0 35.0 37.0 8 35.76825 37.0 35.0 37.0 33.0 37.0 9 37.67525 39.0 37.0 39.0 35.0 39.0 10 37.3485 39.0 37.0 39.0 34.0 39.0 11 37.596 39.0 37.0 39.0 35.0 39.0 12 37.54975 39.0 37.0 39.0 35.0 39.0 13 37.51825 39.0 37.0 39.0 35.0 39.0 14 38.80625 40.0 38.0 41.0 35.0 41.0 15 38.88125 40.0 38.0 41.0 35.0 41.0 16 38.79075 40.0 38.0 41.0 35.0 41.0 17 38.90325 40.0 38.0 41.0 35.0 41.0 18 38.733 40.0 38.0 41.0 34.0 41.0 19 38.871 40.0 38.0 41.0 35.0 41.0 20 38.82425 40.0 38.0 41.0 35.0 41.0 21 38.7535 40.0 38.0 41.0 34.0 41.0 22 38.69575 40.0 38.0 41.0 34.0 41.0 23 38.70825 40.0 38.0 41.0 34.0 41.0 24 38.542 40.0 38.0 41.0 34.0 41.0 25 38.62825 40.0 38.0 41.0 34.0 41.0 26 38.546 40.0 38.0 41.0 34.0 41.0 27 38.24475 40.0 38.0 41.0 33.0 41.0 28 38.2925 40.0 38.0 41.0 34.0 41.0 29 38.262 40.0 38.0 41.0 33.0 41.0 30 38.213 40.0 38.0 41.0 33.0 41.0 31 38.095 40.0 38.0 41.0 33.0 41.0 32 38.01875 40.0 38.0 41.0 33.0 41.0 33 37.8475 40.0 37.0 41.0 33.0 41.0 34 38.04975 40.0 38.0 41.0 33.0 41.0 35 37.9605 40.0 38.0 41.0 33.0 41.0 36 37.90525 40.0 38.0 41.0 33.0 41.0 37 37.777 40.0 37.0 41.0 32.0 41.0 38 37.66575 40.0 37.0 41.0 32.0 41.0 39 37.755 40.0 37.0 41.0 33.0 41.0 40 37.52175 40.0 37.0 41.0 31.0 41.0 41 37.5585 40.0 37.0 41.0 32.0 41.0 42 37.37325 40.0 37.0 41.0 31.0 41.0 43 37.36375 40.0 37.0 41.0 31.0 41.0 44 37.18625 40.0 37.0 41.0 31.0 41.0 45 37.0165 40.0 36.0 41.0 30.0 41.0 46 36.88525 40.0 36.0 41.0 30.0 41.0 47 36.91975 40.0 36.0 41.0 30.0 41.0 48 36.7755 39.0 36.0 41.0 30.0 41.0 49 36.54125 39.0 35.0 41.0 29.0 41.0 50 36.46125 39.0 35.0 41.0 28.0 41.0 51 36.511 39.0 35.0 41.0 29.0 41.0 52 34.99325 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2304 1 0.0 2304 2 0.0 2304 3 0.0 2304 4 0.0 2304 5 0.0 2304 6 0.0 2304 7 0.0 2304 8 0.0 2304 9 0.0 2304 10 0.0 2304 11 0.0 2304 12 0.0 2304 13 0.0 2304 14 0.0 2304 15 0.0 2304 16 0.0 2304 17 0.0 2304 18 0.0 2304 19 0.0 2304 20 0.0 2304 21 0.0 2304 22 0.0 2304 23 0.0 2304 24 0.0 2304 25 0.0 2304 26 0.0 2304 27 0.0 2304 28 0.0 2304 29 0.0 2304 30 0.0 2304 31 0.0 2304 32 0.0 2304 33 0.0 2304 34 0.0 2304 35 0.0 2304 36 0.0 2304 37 0.0 2304 38 0.0 2304 39 0.0 2304 40 0.0 2304 41 0.0 2304 42 0.0 2304 43 0.0 2304 44 0.0 2304 45 0.0 2304 46 0.0 2304 47 0.0 2304 48 0.0 2304 49 0.0 2304 50 0.0 2304 51 0.0 2304 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 3.0 22 3.0 23 9.0 24 9.0 25 17.0 26 26.0 27 34.0 28 30.0 29 60.0 30 53.0 31 56.0 32 95.0 33 144.0 34 145.0 35 198.0 36 286.0 37 411.0 38 751.0 39 1662.0 40 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.034758689672415 12.003000750187546 6.57664416104026 42.385596399099775 2 23.674999999999997 13.875000000000002 35.5 26.950000000000003 3 20.549999999999997 17.474999999999998 23.150000000000002 38.824999999999996 4 24.2 27.525 21.425 26.85 5 22.400000000000002 31.6 24.4 21.6 6 19.725 33.675 23.875 22.725 7 15.0 22.875 42.025 20.1 8 17.675 23.3 31.45 27.575 9 17.424999999999997 22.975 33.0 26.6 10 18.05 38.475 24.65 18.825 11 22.725 28.025 22.3 26.950000000000003 12 21.7 24.55 27.525 26.224999999999998 13 21.125 26.55 26.924999999999997 25.4 14 20.625 27.275 27.575 24.525 15 21.349999999999998 27.525 26.375 24.75 16 19.475 28.1 26.5 25.924999999999997 17 21.4 27.250000000000004 25.724999999999998 25.624999999999996 18 19.7 27.525 25.424999999999997 27.35 19 20.825 28.125 24.474999999999998 26.575 20 20.525 28.375 26.125 24.975 21 22.05 27.125 24.3 26.525 22 21.5 28.075 24.525 25.900000000000002 23 20.775 26.125 24.65 28.449999999999996 24 19.7 28.925 25.474999999999998 25.900000000000002 25 21.65 26.75 25.775 25.825 26 21.325 27.3 26.625 24.75 27 21.349999999999998 27.125 26.125 25.4 28 21.7 26.6 26.325 25.374999999999996 29 20.849999999999998 26.1 27.625 25.424999999999997 30 22.55 24.75 27.150000000000002 25.55 31 19.825 27.200000000000003 26.275 26.700000000000003 32 21.65 27.375 25.85 25.124999999999996 33 21.175 25.324999999999996 27.075 26.424999999999997 34 19.950000000000003 27.875 25.95 26.224999999999998 35 21.75 26.55 26.125 25.575 36 21.525 27.05 25.624999999999996 25.8 37 20.875 26.375 26.25 26.5 38 21.075 27.6 24.9 26.424999999999997 39 22.075 25.874999999999996 25.45 26.6 40 20.51025512756378 26.088044022011005 26.463231615807903 26.93846923461731 41 21.099999999999998 25.75 25.7 27.450000000000003 42 21.25 25.650000000000002 25.6 27.500000000000004 43 21.65 27.700000000000003 25.900000000000002 24.75 44 21.375 26.275 26.325 26.025 45 22.1 26.75 26.325 24.825 46 23.55588897224306 25.98149537384346 25.331332833208304 25.131282820705174 47 22.761380690345174 26.263131565782892 24.68734367183592 26.28814407203602 48 21.675 27.175 25.025 26.125 49 20.66033016508254 27.763881940970485 26.3631815907954 25.212606303151574 50 21.425 26.1 25.5 26.974999999999998 51 21.635817908954476 26.738369184592298 25.962981490745374 25.662831415707853 52 22.3 27.1 23.9 26.700000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.5 10 2.0 11 2.0 12 2.0 13 1.0 14 1.0 15 2.0 16 2.5 17 3.0 18 4.0 19 5.0 20 6.5 21 8.0 22 9.5 23 11.0 24 19.5 25 28.0 26 29.0 27 30.0 28 43.0 29 56.0 30 62.5 31 69.0 32 87.0 33 105.0 34 111.5 35 118.0 36 132.5 37 147.0 38 185.0 39 218.5 40 214.0 41 258.0 42 302.0 43 279.0 44 256.0 45 302.0 46 348.0 47 320.0 48 292.0 49 273.0 50 254.0 51 285.5 52 317.0 53 302.0 54 287.0 55 254.0 56 221.0 57 203.5 58 186.0 59 161.5 60 137.0 61 129.5 62 122.0 63 104.5 64 77.5 65 68.0 66 46.5 67 25.0 68 22.0 69 19.0 70 20.0 71 21.0 72 15.5 73 10.0 74 8.0 75 6.0 76 5.5 77 5.0 78 5.5 79 6.0 80 4.0 81 2.0 82 2.0 83 2.0 84 1.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.05 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.05 48 0.0 49 0.05 50 0.0 51 0.05 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 97.11588883062402 92.60000000000001 2 1.9926586261143155 3.8 3 0.39328788673308857 1.125 4 0.26219192448872575 1.0 5 0.1048767697954903 0.5 6 0.026219192448872573 0.15 7 0.026219192448872573 0.17500000000000002 8 0.05243838489774515 0.4 9 0.0 0.0 >10 0.026219192448872573 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 10 0.25 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 8 0.2 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 8 0.2 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 7 0.17500000000000002 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit CAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCG 5 0.125 No Hit GTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTA 5 0.125 No Hit CTTGTCCGTACCAGTTCTGAGTCGACTGTTCGACGCCCGGGGAAGGCCCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra Read 200000 spots for SRR5423379.sra Written 200000 spots for SRR5423379.sra SRR ids: ['SRR5423379.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k7mlyvg8 SRR5423379.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423379 file size 703926 SRR5423379 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423379 SRR5423379_1.fastq Input file: SRR5423379_1.fastq trimmed: SRR5423379-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 04:32:16 2025 >> started Thu Feb 13 04:33:40 2025 >> done (84.088s) 4000000 reads processed; of these: 102 ( 0.00%) short reads filtered out after trimming by size control 77 ( 0.00%) empty reads filtered out after trimming by size control 3999821 (100.00%) reads available; of these: 94588 ( 2.36%) trimmed reads available after processing 3905233 (97.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 3 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 2 0.00% 26 0 0.00% 27 7 0.00% 28 12 0.00% 29 8 0.00% 30 9 0.00% 31 13 0.00% 32 24 0.00% 33 29 0.00% 34 35 0.00% 35 34 0.00% 36 36 0.00% 37 58 0.00% 38 56 0.00% 39 77 0.00% 40 84 0.00% 41 115 0.00% 42 144 0.00% 43 171 0.00% 44 304 0.01% 45 432 0.01% 46 665 0.02% 47 1003 0.03% 48 1822 0.05% 49 3885 0.10% 50 11798 0.29% 51 73749 1.84% 52 3905233 97.64% 3999821 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=13.55 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.8 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCCC Started job on | Feb 13 04:40:08 Started mapping on | Feb 13 04:40:24 Finished on | Feb 13 05:20:43 Mapping speed, Million of reads per hour | 5.95 Number of input reads | 3999821 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3199036 Uniquely mapped reads % | 79.98% Average mapped length | 51.77 Number of splices: Total | 297423 Number of splices: Annotated (sjdb) | 290886 Number of splices: GT/AG | 290105 Number of splices: GC/AG | 5243 Number of splices: AT/AC | 693 Number of splices: Non-canonical | 1382 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409768 % of reads mapped to multiple loci | 10.24% Number of reads mapped to too many loci | 279772 % of reads mapped to too many loci | 6.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 391017 391017 391017 N_multimapping 409768 409768 409768 N_noFeature 541347 3125485 606186 N_ambiguous 17998 129 9179 UnstrandedReadsAssigned:2639691 PositiveStrandReadsAssigned:73422 NegativeStrandReadsAssigned:2583671 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423379 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423379-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,821 reads, 3,028,943 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR5423379.ke.tsv 34699 SRR5423379.se.tsv 87100 total ==> SRR5423379.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 339 63.8064 Potri.005G024800.1.v4.1 1035 936 27 10.419 Potri.004G059700.1.v4.1 961 862 2 0.838035 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 68.3172 8.6764 Potri.016G087400.1.v4.1 270 171 16 33.7958 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 17.81 3.84281 Potri.012G127500.1.v4.1 977 878 104 42.7837 ==> SRR5423379.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 30 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423379 completed mapping pipeline successfully