Starting /dee2/code/volunteer_pipeline.sh SRR5423380 current disk space = 3051701469184 free memory = 1574601908 SRR5423380 SRAfilesize 5ca900337c79262e3c45192b6175a5b7 SRR5423380.sra SRR5423380.sra file validated SRR5423380 is single end SRR5423380 is conventional basespace SRR5423380 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423380_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.11875 31.0 31.0 34.0 28.0 34.0 2 30.9275 31.0 31.0 34.0 27.0 34.0 3 31.4785 31.0 31.0 34.0 30.0 34.0 4 33.12075 35.0 33.0 37.0 26.0 37.0 5 33.92925 35.0 33.0 37.0 28.0 37.0 6 34.20575 35.0 35.0 37.0 30.0 37.0 7 31.63475 35.0 32.0 37.0 17.0 37.0 8 33.938 35.0 33.0 37.0 28.0 37.0 9 35.53975 37.0 35.0 39.0 30.0 39.0 10 36.0125 37.0 35.0 39.0 32.0 39.0 11 36.288 38.0 35.0 39.0 32.0 39.0 12 35.84125 37.0 35.0 39.0 30.0 39.0 13 35.72025 37.0 35.0 39.0 30.0 39.0 14 36.61025 38.0 36.0 40.0 30.0 41.0 15 36.776 38.0 36.0 40.0 31.0 41.0 16 36.79475 39.0 36.0 40.0 31.0 41.0 17 36.98075 39.0 36.0 40.0 31.0 41.0 18 37.0 39.0 36.0 40.0 31.0 41.0 19 37.108 39.0 36.0 40.0 31.0 41.0 20 37.53825 39.0 36.0 40.0 32.0 41.0 21 37.77675 39.0 37.0 40.0 33.0 41.0 22 36.0415 39.0 35.0 40.0 27.0 41.0 23 37.382 39.0 36.0 40.0 32.0 41.0 24 37.2275 39.0 36.0 40.0 32.0 41.0 25 37.14325 39.0 36.0 40.0 31.0 41.0 26 37.29225 39.0 36.0 40.0 32.0 41.0 27 37.091 39.0 36.0 40.0 31.0 41.0 28 36.7555 39.0 36.0 40.0 30.0 41.0 29 37.00225 39.0 36.0 40.0 31.0 41.0 30 36.8145 39.0 36.0 40.0 30.0 41.0 31 36.20925 38.0 35.0 40.0 29.0 41.0 32 36.265 38.0 35.0 40.0 30.0 41.0 33 36.70675 39.0 36.0 40.0 30.0 41.0 34 36.80025 39.0 36.0 40.0 30.0 41.0 35 36.79075 39.0 36.0 40.0 30.0 41.0 36 36.43425 38.0 35.0 40.0 30.0 41.0 37 36.621 39.0 35.0 40.0 30.0 41.0 38 35.93875 38.0 34.0 40.0 27.0 41.0 39 35.6115 38.0 34.0 40.0 27.0 41.0 40 36.2585 38.0 35.0 40.0 30.0 41.0 41 36.1845 38.0 35.0 40.0 30.0 41.0 42 36.00825 38.0 35.0 40.0 29.0 41.0 43 35.339 38.0 33.0 40.0 27.0 41.0 44 35.77325 38.0 34.0 40.0 28.0 41.0 45 35.99 38.0 34.0 40.0 29.0 41.0 46 36.06925 38.0 34.0 40.0 29.0 41.0 47 34.70025 37.0 33.0 40.0 24.0 41.0 48 35.257 38.0 33.0 40.0 26.0 41.0 49 35.21625 38.0 33.0 40.0 27.0 41.0 50 35.31175 38.0 33.0 40.0 27.0 41.0 51 35.3055 38.0 33.0 40.0 27.0 41.0 52 34.973 37.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2316 1 0.0 2316 2 0.0 2316 3 0.0 2316 4 0.0 2316 5 0.0 2316 6 0.0 2316 7 0.0 2316 8 0.0 2316 9 0.0 2316 10 0.0 2316 11 0.0 2316 12 0.0 2316 13 0.0 2316 14 0.0 2316 15 0.0 2316 16 0.0 2316 17 0.0 2316 18 0.0 2316 19 0.0 2316 20 0.0 2316 21 0.0 2316 22 0.0 2316 23 0.0 2316 24 0.0 2316 25 0.0 2316 26 0.0 2316 27 0.0 2316 28 0.0 2316 29 0.0 2316 30 0.0 2316 31 0.0 2316 32 0.0 2316 33 0.0 2316 34 0.0 2316 35 0.0 2316 36 0.0 2316 37 0.0 2316 38 0.0 2316 39 0.0 2316 40 0.0 2316 41 0.0 2316 42 0.0 2316 43 0.0 2316 44 0.0 2316 45 0.0 2316 46 0.0 2316 47 0.0 2316 48 0.0 2316 49 0.0 2316 50 0.0 2316 51 0.0 2316 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 5.0 23 11.0 24 12.0 25 22.0 26 28.0 27 52.0 28 60.0 29 108.0 30 113.0 31 163.0 32 201.0 33 247.0 34 295.0 35 398.0 36 452.0 37 565.0 38 668.0 39 596.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.525 12.6 6.15 43.725 2 23.150000000000002 14.875 34.150000000000006 27.825 3 22.275 18.9 24.675 34.150000000000006 4 23.9 26.1 23.425 26.575 5 23.65 31.45 24.099999999999998 20.8 6 18.35 33.825 25.05 22.775000000000002 7 15.275 22.875 43.35 18.5 8 17.25 23.925 31.225 27.6 9 17.224999999999998 22.525000000000002 32.824999999999996 27.425 10 17.675 39.050000000000004 23.175 20.1 11 22.075 29.45 22.25 26.224999999999998 12 19.925 25.95 27.625 26.5 13 19.7 27.85 27.025 25.424999999999997 14 20.825 28.725 26.924999999999997 23.525 15 19.725 28.325 26.625 25.324999999999996 16 19.5 27.800000000000004 26.575 26.125 17 21.349999999999998 27.775 26.400000000000002 24.474999999999998 18 19.525000000000002 27.425 27.750000000000004 25.3 19 20.849999999999998 27.05 25.525 26.575 20 21.675 25.2 27.85 25.275 21 19.650000000000002 26.625 27.525 26.200000000000003 22 21.2 26.974999999999998 25.25 26.575 23 20.200000000000003 27.650000000000002 26.35 25.8 24 20.45 26.85 26.200000000000003 26.5 25 21.025 27.55 25.374999999999996 26.05 26 22.275 27.625 25.924999999999997 24.175 27 21.85 27.375 25.45 25.324999999999996 28 21.224999999999998 28.025 26.424999999999997 24.325 29 21.375 26.075 26.825 25.724999999999998 30 20.849999999999998 26.724999999999998 26.875 25.55 31 21.224999999999998 28.775000000000002 24.25 25.75 32 21.2 27.55 27.275 23.974999999999998 33 19.475 27.500000000000004 27.625 25.4 34 22.2 27.250000000000004 25.474999999999998 25.074999999999996 35 20.075000000000003 26.224999999999998 27.1 26.6 36 19.8 26.375 25.25 28.575 37 22.25 26.950000000000003 25.074999999999996 25.724999999999998 38 21.325 26.950000000000003 25.900000000000002 25.825 39 19.904976244061015 26.30657664416104 26.38159539884971 27.406851712928233 40 20.825 27.425 27.05 24.7 41 22.675 27.150000000000002 25.05 25.124999999999996 42 20.45 26.0 26.924999999999997 26.625 43 21.925 26.200000000000003 26.05 25.825 44 21.55 26.200000000000003 26.424999999999997 25.825 45 20.974999999999998 26.625 26.1 26.3 46 21.65 27.0 26.375 24.975 47 22.455613903475868 27.031757939484873 25.681420355088775 24.831207801950487 48 23.275000000000002 26.275 25.224999999999998 25.224999999999998 49 22.030507626906726 26.456614153538382 25.63140785196299 25.881470367591895 50 20.8 26.375 26.674999999999997 26.150000000000002 51 21.330332583145786 25.63140785196299 26.056514128532132 26.981745436359088 52 21.099999999999998 25.85 26.125 26.924999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.5 14 0.5 15 1.0 16 1.0 17 1.0 18 4.0 19 7.0 20 10.0 21 13.0 22 12.5 23 12.0 24 19.0 25 26.0 26 32.5 27 39.0 28 47.0 29 55.0 30 63.0 31 71.0 32 92.0 33 113.0 34 128.5 35 144.0 36 171.0 37 198.0 38 205.0 39 235.5 40 259.0 41 268.5 42 278.0 43 286.0 44 294.0 45 285.0 46 276.0 47 285.0 48 294.0 49 294.5 50 295.0 51 285.0 52 275.0 53 260.0 54 245.0 55 225.5 56 206.0 57 193.5 58 181.0 59 168.5 60 156.0 61 130.0 62 104.0 63 87.5 64 64.5 65 58.0 66 47.5 67 37.0 68 28.0 69 19.0 70 21.0 71 23.0 72 18.5 73 14.0 74 11.5 75 9.0 76 6.5 77 4.0 78 3.5 79 3.0 80 2.5 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.025 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.025 48 0.0 49 0.025 50 0.0 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.2 #Duplication Level Percentage of deduplicated Percentage of total 1 97.63513513513513 93.925 2 1.6372141372141373 3.15 3 0.4937629937629938 1.425 4 0.07796257796257797 0.3 5 0.02598752598752599 0.125 6 0.02598752598752599 0.15 7 0.05197505197505198 0.35000000000000003 8 0.02598752598752599 0.2 9 0.0 0.0 >10 0.02598752598752599 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 15 0.375 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 8 0.2 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 7 0.17500000000000002 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 7 0.17500000000000002 No Hit CCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGG 6 0.15 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14679 spots for SRR5423380.sra Written 14679 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra Read 14669 spots for SRR5423380.sra Written 14669 spots for SRR5423380.sra SRR ids: ['SRR5423380.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h2gu1_d1 SRR5423380.sra spots: 293390 blocks: [[1, 14669], [14670, 29338], [29339, 44007], [44008, 58676], [58677, 73345], [73346, 88014], [88015, 102683], [102684, 117352], [117353, 132021], [132022, 146690], [146691, 161359], [161360, 176028], [176029, 190697], [190698, 205366], [205367, 220035], [220036, 234704], [234705, 249373], [249374, 264042], [264043, 278711], [278712, 293390]] SRR5423380 file size 51305 SRR5423380 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423380 SRR5423380_1.fastq Input file: SRR5423380_1.fastq trimmed: SRR5423380-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 04:28:12 2025 >> started Thu Feb 13 04:30:20 2025 >> done (128.229s) 293390 reads processed; of these: 9 ( 0.00%) short reads filtered out after trimming by size control 5 ( 0.00%) empty reads filtered out after trimming by size control 293376 (100.00%) reads available; of these: 7939 ( 2.71%) trimmed reads available after processing 285437 (97.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 32 1 0.00% 33 2 0.00% 34 0 0.00% 35 0 0.00% 36 2 0.00% 37 0 0.00% 38 3 0.00% 39 1 0.00% 40 1 0.00% 41 1 0.00% 42 3 0.00% 43 8 0.00% 44 4 0.00% 45 11 0.00% 46 28 0.01% 47 42 0.01% 48 87 0.03% 49 206 0.07% 50 819 0.28% 51 6720 2.29% 52 285437 97.29% 293376 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=13 prefix-density=0.20 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=12.34 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGA Started job on | Feb 13 04:34:56 Started mapping on | Feb 13 04:35:09 Finished on | Feb 13 04:40:57 Mapping speed, Million of reads per hour | 3.03 Number of input reads | 293376 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 234848 Uniquely mapped reads % | 80.05% Average mapped length | 51.76 Number of splices: Total | 21927 Number of splices: Annotated (sjdb) | 21491 Number of splices: GT/AG | 21380 Number of splices: GC/AG | 397 Number of splices: AT/AC | 57 Number of splices: Non-canonical | 93 Mismatch rate per base, % | 0.75% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 30396 % of reads mapped to multiple loci | 10.36% Number of reads mapped to too many loci | 19628 % of reads mapped to too many loci | 6.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 28132 28132 28132 N_multimapping 30396 30396 30396 N_noFeature 40725 229960 44986 N_ambiguous 1301 16 660 UnstrandedReadsAssigned:192822 PositiveStrandReadsAssigned:4872 NegativeStrandReadsAssigned:189202 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423380 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423380-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 293,376 reads, 215,637 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 818 rounds 52401 SRR5423380.ke.tsv 34699 SRR5423380.se.tsv 87100 total ==> SRR5423380.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 22 58.2301 Potri.005G024800.1.v4.1 1035 936 2 10.8531 Potri.004G059700.1.v4.1 961 862 1 5.89241 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 11 19.6455 Potri.016G087400.1.v4.1 270 171 2 59.4065 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 3.0342 Potri.012G127500.1.v4.1 977 878 11 63.6353 ==> SRR5423380.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 5 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423380 completed mapping pipeline successfully