Starting /dee2/code/volunteer_pipeline.sh SRR5423389 current disk space = 3051616452608 free memory = 1571527636 SRR5423389 SRAfilesize aa147cc2b45104b4fc6b9b02ae62c0c4 SRR5423389.sra SRR5423389.sra file validated SRR5423389 is single end SRR5423389 is conventional basespace SRR5423389 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423389_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.84775 16.0 16.0 28.0 16.0 30.0 2 22.72925 25.0 16.0 30.0 16.0 30.0 3 24.108 27.0 16.0 30.0 16.0 31.0 4 28.95375 32.0 19.0 35.0 19.0 35.0 5 22.93525 19.0 19.0 30.0 10.0 35.0 6 22.1335 17.0 17.0 30.0 10.0 33.0 7 23.2815 25.0 17.0 32.0 10.0 33.0 8 24.64225 28.0 17.0 32.0 11.0 35.0 9 24.4325 27.0 17.0 32.0 11.0 35.0 10 26.654 30.0 17.0 34.0 15.0 35.0 11 27.057 30.0 17.0 34.0 15.0 35.0 12 25.662 27.0 17.0 34.0 11.0 35.0 13 26.46025 28.0 17.0 34.0 11.0 35.0 14 27.4835 31.0 21.0 34.0 11.0 37.0 15 28.212 32.0 25.0 35.0 16.0 37.0 16 27.70525 31.0 21.0 34.0 11.0 37.0 17 27.7645 31.0 24.0 34.0 11.0 37.0 18 24.522 27.0 17.0 32.0 10.0 36.0 19 26.6 27.0 18.0 34.0 10.0 37.0 20 26.10125 27.0 18.0 34.0 10.0 37.0 21 26.553 29.0 18.0 34.0 10.0 37.0 22 26.4895 29.0 18.0 34.0 10.0 37.0 23 25.94775 27.0 18.0 34.0 10.0 37.0 24 25.52325 27.0 18.0 34.0 10.0 36.0 25 24.13875 27.0 16.0 32.0 10.0 36.0 26 21.22375 22.0 10.0 30.0 8.0 34.0 27 21.17575 21.0 10.0 30.0 8.0 34.0 28 21.9295 24.0 11.0 30.0 9.0 34.0 29 22.6825 25.0 15.0 31.0 9.0 35.0 30 23.239 25.0 15.0 32.0 9.0 35.0 31 23.3735 25.0 15.0 32.0 9.0 35.0 32 19.1955 16.0 9.0 28.0 8.0 34.0 33 20.10225 18.0 9.0 30.0 8.0 34.0 34 21.463 23.0 13.0 30.0 8.0 34.0 35 21.74175 24.0 12.0 30.0 8.0 35.0 36 20.29475 19.0 9.0 30.0 8.0 34.0 37 19.88725 18.0 9.0 30.0 8.0 34.0 38 19.548 18.0 9.0 30.0 8.0 33.0 39 20.11225 21.0 9.0 30.0 8.0 33.0 40 19.84325 19.0 9.0 30.0 8.0 33.0 41 21.20375 23.0 13.0 30.0 8.0 33.0 42 20.86475 23.0 10.0 30.0 8.0 34.0 43 21.2575 23.0 11.0 30.0 8.0 34.0 44 21.6085 23.0 12.0 30.0 8.0 34.0 45 20.57025 22.0 9.0 30.0 8.0 34.0 46 19.452 18.0 9.0 30.0 7.0 33.0 47 19.59025 20.0 9.0 28.0 8.0 33.0 48 19.92975 20.0 9.0 29.0 7.0 33.0 49 18.99675 18.0 9.0 28.0 7.0 33.0 50 18.49725 17.0 9.0 28.0 7.0 33.0 51 16.8815 14.0 8.0 24.0 7.0 31.0 52 16.747 14.0 8.0 24.0 7.0 30.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 1.0 12 3.0 13 2.0 14 9.0 15 35.0 16 62.0 17 136.0 18 211.0 19 288.0 20 379.0 21 457.0 22 481.0 23 473.0 24 426.0 25 363.0 26 294.0 27 170.0 28 117.0 29 63.0 30 21.0 31 6.0 32 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.975 15.525 6.05 35.449999999999996 2 21.9 14.45 33.75 29.9 3 17.599999999999998 21.575 22.825 38.0 4 24.525 27.425 17.275 30.775000000000002 5 36.15 27.275 9.1 27.474999999999998 6 21.9 31.45 22.975 23.674999999999997 7 16.400000000000002 22.325 38.824999999999996 22.45 8 18.175 25.35 26.125 30.349999999999998 9 18.525 19.8 34.65 27.025 10 19.525000000000002 30.599999999999998 24.95 24.925 11 24.0 22.175 21.175 32.65 12 20.674999999999997 21.825 29.475 28.025 13 24.025 25.1 24.95 25.924999999999997 14 21.55 25.874999999999996 27.1 25.474999999999998 15 23.05 24.025 25.575 27.35 16 23.025000000000002 23.925 28.375 24.675 17 21.4 23.1 25.074999999999996 30.425 18 22.55 25.924999999999997 26.474999999999998 25.05 19 21.375 25.324999999999996 25.8 27.500000000000004 20 24.224999999999998 23.3 25.775 26.700000000000003 21 21.425 23.549999999999997 26.174999999999997 28.849999999999998 22 21.025 25.474999999999998 27.200000000000003 26.3 23 24.275 25.124999999999996 26.025 24.575 24 22.5 27.35 22.15 28.000000000000004 25 21.95 27.250000000000004 26.650000000000002 24.15 26 22.8 27.224999999999998 22.5 27.474999999999998 27 22.525000000000002 28.925 24.675 23.875 28 22.875 27.025 26.075 24.025 29 20.7 26.224999999999998 26.174999999999997 26.900000000000002 30 20.549999999999997 27.200000000000003 23.825 28.425 31 23.849999999999998 25.35 24.025 26.775 32 21.9 29.25 23.225 25.624999999999996 33 22.825 26.0 25.324999999999996 25.85 34 25.45 23.325000000000003 21.05 30.175 35 23.225 26.974999999999998 23.0 26.8 36 23.025000000000002 27.500000000000004 22.875 26.6 37 24.975 24.349999999999998 22.55 28.125 38 23.974999999999998 25.974999999999998 22.35 27.700000000000003 39 20.549999999999997 25.174999999999997 25.1 29.175 40 21.224999999999998 26.900000000000002 25.924999999999997 25.95 41 21.0 24.05 25.775 29.175 42 21.55 26.0 22.8 29.65 43 19.900000000000002 27.575 23.674999999999997 28.849999999999998 44 23.549999999999997 26.375 22.650000000000002 27.425 45 23.95 27.474999999999998 21.875 26.700000000000003 46 23.799999999999997 25.6 25.124999999999996 25.474999999999998 47 22.85 26.0 22.625 28.525 48 23.575 25.85 21.95 28.625 49 20.4 26.950000000000003 26.05 26.6 50 22.85 28.375 24.05 24.725 51 22.725 28.199999999999996 22.775000000000002 26.3 52 23.175 28.999999999999996 23.474999999999998 24.349999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 3.5 2 4.0 3 3.5 4 3.0 5 5.0 6 7.0 7 4.0 8 1.0 9 1.5 10 2.0 11 1.5 12 1.0 13 1.5 14 6.0 15 10.0 16 8.0 17 6.0 18 6.0 19 6.0 20 8.0 21 10.0 22 11.5 23 13.0 24 12.5 25 12.0 26 16.0 27 20.0 28 28.0 29 36.0 30 49.0 31 62.0 32 76.5 33 91.0 34 99.5 35 108.0 36 128.0 37 148.0 38 164.5 39 194.0 40 207.0 41 214.0 42 221.0 43 232.5 44 244.0 45 254.5 46 265.0 47 260.5 48 256.0 49 251.0 50 246.0 51 242.0 52 238.0 53 261.5 54 285.0 55 246.0 56 207.0 57 194.5 58 182.0 59 169.5 60 157.0 61 147.5 62 138.0 63 128.5 64 98.0 65 77.0 66 87.0 67 97.0 68 85.5 69 74.0 70 69.0 71 64.0 72 60.5 73 57.0 74 50.0 75 43.0 76 38.0 77 33.0 78 25.5 79 18.0 80 21.0 81 24.0 82 14.0 83 4.0 84 7.0 85 10.0 86 7.5 87 5.0 88 3.5 89 1.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91084093211752 97.625 2 0.911854103343465 1.7999999999999998 3 0.12664640324214793 0.375 4 0.050658561296859174 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7404 spots for SRR5423389.sra Written 7404 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra Read 7389 spots for SRR5423389.sra Written 7389 spots for SRR5423389.sra SRR ids: ['SRR5423389.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t7ifvpii SRR5423389.sra spots: 147795 blocks: [[1, 7389], [7390, 14778], [14779, 22167], [22168, 29556], [29557, 36945], [36946, 44334], [44335, 51723], [51724, 59112], [59113, 66501], [66502, 73890], [73891, 81279], [81280, 88668], [88669, 96057], [96058, 103446], [103447, 110835], [110836, 118224], [118225, 125613], [125614, 133002], [133003, 140391], [140392, 147795]] SRR5423389 file size 25796 SRR5423389 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423389 SRR5423389_1.fastq Input file: SRR5423389_1.fastq trimmed: SRR5423389-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 04:56:52 2025 >> started Thu Feb 13 04:57:24 2025 >> done (32.799s) 147795 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 23 ( 0.02%) empty reads filtered out after trimming by size control 147771 (99.98%) reads available; of these: 32559 (22.03%) trimmed reads available after processing 115212 (77.97%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 3 0.00% 36 0 0.00% 37 0 0.00% 38 2 0.00% 39 0 0.00% 40 3 0.00% 41 4 0.00% 42 11 0.01% 43 20 0.01% 44 42 0.03% 45 68 0.05% 46 136 0.09% 47 281 0.19% 48 674 0.46% 49 1811 1.23% 50 6173 4.18% 51 23330 15.79% 52 115212 77.97% 147771 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=18 prefix-density=0.00 prefix-fanout=1.0 sequence=GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCCCTGCTTCCTCGGGCGGAACTCCAGGTTGAGGAGTTACTCGGAATGCTGCC criterion=fanout-score sequence-density=0.12 sequence-density-rank=8 fanout-score=3.31 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=1.0 sequence=CCCGTCGGTCCCCCCCGTTGTCCCTGTCCCCGTCG Started job on | Feb 13 05:00:14 Started mapping on | Feb 13 05:00:26 Finished on | Feb 13 05:01:47 Mapping speed, Million of reads per hour | 6.57 Number of input reads | 147771 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 92332 Uniquely mapped reads % | 62.48% Average mapped length | 51.23 Number of splices: Total | 6624 Number of splices: Annotated (sjdb) | 6486 Number of splices: GT/AG | 6469 Number of splices: GC/AG | 135 Number of splices: AT/AC | 15 Number of splices: Non-canonical | 5 Mismatch rate per base, % | 3.33% Deletion rate per base | 0.01% Deletion average length | 2.31 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 26475 % of reads mapped to multiple loci | 17.92% Number of reads mapped to too many loci | 2271 % of reads mapped to too many loci | 1.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.98% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 28964 28964 28964 N_multimapping 26475 26475 26475 N_noFeature 14252 90215 16028 N_ambiguous 786 5 440 UnstrandedReadsAssigned:77294 PositiveStrandReadsAssigned:2112 NegativeStrandReadsAssigned:75864 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=51 echo kmer=47 SRR5423389 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423389-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 147,771 reads, 62,311 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 760 rounds 52401 SRR5423389.ke.tsv 34699 SRR5423389.se.tsv 87100 total ==> SRR5423389.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 0 0 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 0 0 Potri.016G087400.1.v4.1 270 171 0 0 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 0 0 ==> SRR5423389.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 0 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423389 completed mapping pipeline successfully