Starting /dee2/code/volunteer_pipeline.sh SRR5423396 current disk space = 3049636065280 free memory = 1582821816 SRR5423396 SRAfilesize 5723450ed1c59f406d470ee6cfaa7de5 SRR5423396.sra SRR5423396.sra file validated SRR5423396 is single end SRR5423396 is conventional basespace SRR5423396 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423396_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.466 31.0 30.0 33.0 27.0 34.0 2 30.602 31.0 30.0 34.0 27.0 34.0 3 31.02925 31.0 31.0 34.0 27.0 34.0 4 30.295 35.0 28.0 37.0 16.0 37.0 5 33.6005 35.0 33.0 37.0 28.0 37.0 6 34.387 35.0 35.0 37.0 31.0 37.0 7 34.465 35.0 35.0 37.0 31.0 37.0 8 34.88075 35.0 35.0 37.0 32.0 37.0 9 36.608 38.0 35.0 39.0 32.0 39.0 10 36.29175 38.0 35.0 39.0 32.0 39.0 11 36.5565 38.0 35.0 39.0 32.0 39.0 12 36.65875 39.0 35.0 39.0 32.0 39.0 13 36.38375 38.0 35.0 39.0 32.0 39.0 14 37.514 40.0 36.0 41.0 32.0 41.0 15 37.2795 39.0 36.0 41.0 31.0 41.0 16 37.60025 39.0 36.0 41.0 32.0 41.0 17 37.519 39.0 36.0 41.0 32.0 41.0 18 37.7795 39.0 37.0 41.0 33.0 41.0 19 37.77625 40.0 37.0 41.0 32.0 41.0 20 36.94875 39.0 36.0 41.0 30.0 41.0 21 37.4615 39.0 36.0 40.0 32.0 41.0 22 37.34125 39.0 36.0 40.0 32.0 41.0 23 37.47025 39.0 36.0 40.0 32.0 41.0 24 37.34575 39.0 36.0 40.0 32.0 41.0 25 36.8715 39.0 36.0 40.0 30.0 41.0 26 37.12325 39.0 36.0 40.0 31.0 41.0 27 37.275 39.0 36.0 40.0 31.0 41.0 28 37.49475 39.0 36.0 41.0 32.0 41.0 29 37.041 39.0 36.0 40.0 31.0 41.0 30 36.47875 39.0 35.0 40.0 30.0 41.0 31 36.289 38.0 35.0 40.0 30.0 41.0 32 37.12125 39.0 36.0 40.0 31.0 41.0 33 34.88825 38.0 33.0 40.0 24.0 41.0 34 36.03725 38.0 35.0 40.0 29.0 41.0 35 36.26825 38.0 35.0 40.0 30.0 41.0 36 36.79625 38.0 35.0 40.0 30.0 41.0 37 36.70275 39.0 35.0 40.0 30.0 41.0 38 36.5565 38.0 35.0 40.0 30.0 41.0 39 36.5255 38.0 35.0 40.0 30.0 41.0 40 36.47725 39.0 35.0 40.0 30.0 41.0 41 36.40375 38.0 35.0 40.0 30.0 41.0 42 36.20625 38.0 35.0 40.0 29.0 41.0 43 36.03875 38.0 35.0 40.0 29.0 41.0 44 35.8165 38.0 34.0 40.0 28.0 41.0 45 35.65875 38.0 34.0 40.0 27.0 41.0 46 36.1095 38.0 35.0 40.0 29.0 41.0 47 36.46075 38.0 35.0 40.0 30.0 41.0 48 36.24425 38.0 35.0 40.0 29.0 41.0 49 36.2345 38.0 35.0 40.0 29.0 41.0 50 36.01225 38.0 34.0 40.0 29.0 41.0 51 35.90975 38.0 34.0 40.0 28.0 41.0 52 34.84775 37.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2315 1 0.0 2315 2 0.0 2315 3 0.0 2315 4 0.0 2315 5 0.0 2315 6 0.0 2315 7 0.0 2315 8 0.0 2315 9 0.0 2315 10 0.0 2315 11 0.0 2315 12 0.0 2315 13 0.0 2315 14 0.0 2315 15 0.0 2315 16 0.0 2315 17 0.0 2315 18 0.0 2315 19 0.0 2315 20 0.0 2315 21 0.0 2315 22 0.0 2315 23 0.0 2315 24 0.0 2315 25 0.0 2315 26 0.0 2315 27 0.0 2315 28 0.0 2315 29 0.0 2315 30 0.0 2315 31 0.0 2315 32 0.0 2315 33 0.0 2315 34 0.0 2315 35 0.0 2315 36 0.0 2315 37 0.0 2315 38 0.0 2315 39 0.0 2315 40 0.0 2315 41 0.0 2315 42 0.0 2315 43 0.0 2315 44 0.0 2315 45 0.0 2315 46 0.0 2315 47 0.0 2315 48 0.0 2315 49 0.0 2315 50 0.0 2315 51 0.0 2315 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 1.0 21 5.0 22 7.0 23 6.0 24 14.0 25 17.0 26 21.0 27 34.0 28 62.0 29 83.0 30 126.0 31 148.0 32 173.0 33 229.0 34 290.0 35 349.0 36 458.0 37 538.0 38 744.0 39 691.0 40 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.13553388347086 14.328582145536384 6.27656914228557 37.259314828707176 2 20.8 15.25 35.0 28.95 3 19.6 20.25 25.2 34.949999999999996 4 25.074999999999996 27.250000000000004 23.05 24.625 5 24.6 33.675 22.650000000000002 19.075 6 20.525 35.475 22.45 21.55 7 15.65 24.625 40.25 19.475 8 16.75 24.425 29.7 29.125 9 18.325 22.55 33.5 25.624999999999996 10 20.5 39.65 21.55 18.3 11 22.7 28.499999999999996 21.25 27.55 12 21.224999999999998 26.025 25.0 27.750000000000004 13 19.225 29.375 27.200000000000003 24.2 14 19.650000000000002 29.575000000000003 27.85 22.925 15 20.825 27.150000000000002 26.674999999999997 25.35 16 21.8 26.8 26.575 24.825 17 22.725 26.700000000000003 25.624999999999996 24.95 18 20.474999999999998 26.05 26.924999999999997 26.55 19 21.175 27.150000000000002 25.575 26.1 20 20.1 28.549999999999997 26.25 25.1 21 20.9 26.200000000000003 27.150000000000002 25.75 22 21.75 27.775 25.25 25.224999999999998 23 20.75 28.599999999999998 25.85 24.8 24 21.55 29.275000000000002 25.724999999999998 23.45 25 22.55 27.950000000000003 24.9 24.6 26 21.5 28.325 26.0 24.175 27 20.7 28.275 25.8 25.224999999999998 28 22.475 28.325 25.374999999999996 23.825 29 20.275000000000002 28.1 27.474999999999998 24.15 30 19.775000000000002 26.85 27.900000000000002 25.474999999999998 31 21.825 27.900000000000002 25.275 25.0 32 21.5 27.800000000000004 24.55 26.150000000000002 33 21.3 27.425 26.625 24.65 34 21.675 26.275 26.525 25.525 35 21.775 26.3 24.45 27.474999999999998 36 20.125 26.674999999999997 24.925 28.275 37 21.55 27.35 24.9 26.200000000000003 38 22.375 26.625 24.4 26.6 39 22.25 27.825 25.324999999999996 24.6 40 22.030507626906726 28.00700175043761 25.656414103525883 24.306076519129782 41 20.65 27.325 26.424999999999997 25.6 42 20.0 26.974999999999998 26.025 27.0 43 21.475 28.575 24.675 25.275 44 22.7 28.249999999999996 24.075 24.975 45 21.605401350337583 26.506626656664167 26.456614153538382 25.431357839459867 46 22.375 27.775 25.025 24.825 47 22.425 28.875 25.45 23.25 48 22.275 28.000000000000004 25.45 24.275 49 21.45536384096024 28.132033008252062 24.381095273818453 26.03150787696924 50 22.0 26.674999999999997 24.8 26.525 51 21.580395098774694 27.38184546136534 24.981245311327832 26.056514128532132 52 23.549999999999997 26.125 24.775 25.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 2.5 8 4.0 9 2.5 10 1.0 11 1.5 12 2.0 13 1.5 14 1.0 15 1.0 16 2.5 17 4.0 18 6.0 19 8.0 20 9.0 21 10.0 22 11.0 23 12.0 24 15.5 25 19.0 26 28.0 27 37.0 28 39.0 29 41.0 30 57.5 31 74.0 32 88.5 33 103.0 34 120.5 35 138.0 36 159.5 37 181.0 38 203.5 39 232.0 40 238.0 41 242.5 42 247.0 43 268.5 44 290.0 45 299.5 46 309.0 47 294.5 48 280.0 49 287.0 50 294.0 51 317.0 52 340.0 53 315.0 54 290.0 55 251.0 56 212.0 57 190.5 58 169.0 59 163.5 60 158.0 61 138.0 62 118.0 63 96.5 64 58.0 65 41.0 66 37.0 67 33.0 68 22.0 69 11.0 70 11.0 71 11.0 72 7.0 73 3.0 74 2.5 75 2.0 76 4.0 77 6.0 78 4.0 79 2.0 80 2.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.025 41 0.0 42 0.0 43 0.0 44 0.0 45 0.025 46 0.0 47 0.0 48 0.0 49 0.025 50 0.0 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.24022346368716 83.45 2 4.5530726256983245 8.15 3 1.0893854748603353 2.9250000000000003 4 0.44692737430167595 1.6 5 0.27932960893854747 1.25 6 0.19553072625698326 1.05 7 0.027932960893854747 0.17500000000000002 8 0.055865921787709494 0.4 9 0.055865921787709494 0.44999999999999996 >10 0.055865921787709494 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 12 0.3 No Hit GCCGAATACACCAGCTACGCCTAACATGTGAAATGGGTGCATAAGGATGTTG 10 0.25 No Hit GTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCA 9 0.22499999999999998 No Hit CTAACATGTGAAATGGGTGCATAAGGATGTTGTGCTCAGCCTGGAATACAAT 9 0.22499999999999998 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 8 0.2 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 8 0.2 No Hit GCCAGACTAAGCAATAAAGTACCTCGTATTTTCCCCTCTGCCTCGGGTTGTC 7 0.17500000000000002 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 6 0.15 No Hit GGTGCATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGT 6 0.15 No Hit GATCAAACTAGAGGTTACCAAAGAACCATGCATAGCACTGAATAGGGAGCCG 6 0.15 No Hit GTTAATAATATCAGCCCAGGTATTAATTACACGACCTTGACTATCAACTACA 6 0.15 No Hit CCCAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATT 6 0.15 No Hit CCGCATTTCGCTAAAGGGTTGAAGGAGGATAGTGCATCAAGCTGTTCGCAAG 6 0.15 No Hit GGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGAT 6 0.15 No Hit CCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCCCT 5 0.125 No Hit CTCACGAGCAAGATCACGTCCCTCATTACGAGCTTGTACACATGCTTCTAGA 5 0.125 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 5 0.125 No Hit GCCTAACATGTGAAATGGGTGCATAAGGATGTTGTGCTCAGCCTGGAATACA 5 0.125 No Hit CCAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATTG 5 0.125 No Hit GTAGAAGATTCAGCAGCTACTGCGGCCCCTGCTTCCTCGGGCGGAACTCCAG 5 0.125 No Hit GTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCC 5 0.125 No Hit GTGCATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGTA 5 0.125 No Hit ATCAAACTAGAGGTTACCAAAGAACCATGCATAGCACTGAATAGGGAGCCGC 5 0.125 No Hit CTCAGCCTGGAATACAATCATAAAGTTAAAAGTACCAGAGATTCCTAGAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27732 spots for SRR5423396.sra Written 27732 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra Read 27726 spots for SRR5423396.sra Written 27726 spots for SRR5423396.sra SRR ids: ['SRR5423396.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pb_mnqib SRR5423396.sra spots: 554526 blocks: [[1, 27726], [27727, 55452], [55453, 83178], [83179, 110904], [110905, 138630], [138631, 166356], [166357, 194082], [194083, 221808], [221809, 249534], [249535, 277260], [277261, 304986], [304987, 332712], [332713, 360438], [360439, 388164], [388165, 415890], [415891, 443616], [443617, 471342], [471343, 499068], [499069, 526794], [526795, 554526]] SRR5423396 file size 97076 SRR5423396 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423396 SRR5423396_1.fastq Input file: SRR5423396_1.fastq trimmed: SRR5423396-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 09:28:00 2025 >> started Wed Feb 12 09:28:00 2025 >> done (0.381s) 554526 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 113 ( 0.02%) empty reads filtered out after trimming by size control 554405 (99.98%) reads available; of these: 12993 ( 2.34%) trimmed reads available after processing 541412 (97.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 2 0.00% 34 1 0.00% 35 3 0.00% 36 1 0.00% 37 3 0.00% 38 2 0.00% 39 5 0.00% 40 2 0.00% 41 5 0.00% 42 2 0.00% 43 5 0.00% 44 18 0.00% 45 26 0.00% 46 39 0.01% 47 58 0.01% 48 129 0.02% 49 350 0.06% 50 1279 0.23% 51 11060 1.99% 52 541412 97.66% 554405 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=20 prefix-density=0.32 prefix-fanout=1.9 sequence=TGGCACCGGCCCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACCAGCCTCACGCTGTGCCCTCCCCTCTAGGAGCCACGACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=32.02 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=1.1 sequence=CCCCTCTGCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAG Started job on | Feb 12 09:28:11 Started mapping on | Feb 12 09:28:11 Finished on | Feb 12 09:28:15 Mapping speed, Million of reads per hour | 498.96 Number of input reads | 554405 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 414386 Uniquely mapped reads % | 74.74% Average mapped length | 51.79 Number of splices: Total | 34954 Number of splices: Annotated (sjdb) | 34462 Number of splices: GT/AG | 33864 Number of splices: GC/AG | 867 Number of splices: AT/AC | 116 Number of splices: Non-canonical | 107 Mismatch rate per base, % | 0.66% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 119425 % of reads mapped to multiple loci | 21.54% Number of reads mapped to too many loci | 9749 % of reads mapped to too many loci | 1.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.80% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 20594 20594 20594 N_multimapping 119425 119425 119425 N_noFeature 63511 404869 71531 N_ambiguous 3065 14 1556 UnstrandedReadsAssigned:347810 PositiveStrandReadsAssigned:9503 NegativeStrandReadsAssigned:341299 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423396 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423396-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 554,405 reads, 427,800 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 855 rounds 52401 SRR5423396.ke.tsv 34699 SRR5423396.se.tsv 87100 total ==> SRR5423396.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 10 10.2666 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 9 6.23467 Potri.016G087400.1.v4.1 270 171 2 23.0428 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 0 0 ==> SRR5423396.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 6 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423396 completed mapping pipeline successfully