Starting /dee2/code/volunteer_pipeline.sh SRR5423408 current disk space = 3053176721408 free memory = 1577351748 SRR5423408 SRAfilesize cc4dd3534d6353b72ba08adb8b39bd98 SRR5423408.sra SRR5423408.sra file validated SRR5423408 is single end SRR5423408 is conventional basespace SRR5423408 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423408_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.74525 16.0 16.0 26.0 16.0 30.0 2 22.91725 25.0 16.0 30.0 16.0 30.0 3 24.222 27.0 16.0 30.0 16.0 31.0 4 29.11775 32.0 19.0 35.0 19.0 35.0 5 23.2735 19.0 19.0 32.0 10.0 35.0 6 22.1695 17.0 17.0 31.0 10.0 33.0 7 23.043 25.0 17.0 32.0 10.0 33.0 8 24.399 27.0 17.0 32.0 11.0 35.0 9 24.0965 27.0 17.0 32.0 11.0 35.0 10 26.3585 28.0 17.0 34.0 15.0 35.0 11 27.0755 30.0 17.0 34.0 15.0 35.0 12 25.902 27.0 17.0 34.0 11.0 35.0 13 26.5605 29.0 17.0 34.0 11.0 35.0 14 27.4375 30.0 19.0 34.0 11.0 37.0 15 28.17275 31.0 25.0 34.0 16.0 37.0 16 27.9955 31.0 25.0 34.0 16.0 37.0 17 28.0155 31.0 25.0 34.0 16.0 37.0 18 24.723 27.0 17.0 32.0 10.0 36.0 19 26.86625 29.0 18.0 34.0 11.0 37.0 20 26.4015 29.0 18.0 34.0 10.0 37.0 21 26.8785 30.0 19.0 34.0 10.0 37.0 22 26.80225 30.0 18.0 34.0 10.0 37.0 23 25.61525 27.0 18.0 34.0 10.0 37.0 24 25.293 27.0 18.0 33.0 10.0 37.0 25 24.65675 27.0 17.0 33.0 10.0 36.0 26 21.6915 23.0 10.0 31.0 9.0 35.0 27 21.9055 24.0 10.0 31.0 9.0 34.0 28 22.415 25.0 13.0 31.0 9.0 35.0 29 23.08075 25.0 15.0 32.0 9.0 35.0 30 23.695 25.0 16.0 32.0 9.0 35.0 31 23.618 25.0 16.0 32.0 9.0 35.0 32 19.28775 16.0 9.0 28.0 8.0 34.0 33 20.141 17.0 9.0 30.0 8.0 34.0 34 21.84625 24.0 15.0 30.0 9.0 34.0 35 22.04075 24.0 13.0 30.0 8.0 35.0 36 20.9535 23.0 9.0 30.0 8.0 34.0 37 20.70375 21.0 9.0 30.0 8.0 34.0 38 20.121 19.0 9.0 30.0 8.0 34.0 39 20.653 22.0 9.0 30.0 8.0 34.0 40 20.4775 22.0 9.0 30.0 8.0 34.0 41 21.6085 24.0 13.0 30.0 8.0 34.0 42 20.817 22.0 9.0 30.0 8.0 34.0 43 21.4255 23.0 12.0 30.0 8.0 34.0 44 21.7095 24.0 12.0 30.0 8.0 35.0 45 20.72125 23.0 9.0 30.0 8.0 34.0 46 20.05625 20.0 9.0 30.0 8.0 34.0 47 20.005 21.0 9.0 30.0 8.0 33.0 48 20.116 21.0 9.0 30.0 8.0 33.0 49 19.34575 19.0 9.0 28.0 7.0 33.0 50 19.25425 20.0 9.0 28.0 7.0 33.0 51 17.20625 14.0 8.0 26.0 7.0 31.0 52 16.96225 14.0 8.0 24.0 7.0 31.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 12 2.0 13 3.0 14 6.0 15 28.0 16 57.0 17 124.0 18 194.0 19 266.0 20 330.0 21 441.0 22 475.0 23 492.0 24 454.0 25 408.0 26 275.0 27 220.0 28 118.0 29 64.0 30 31.0 31 10.0 32 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.525 13.925 6.05 53.5 2 22.975 13.225000000000001 38.425 25.374999999999996 3 20.424999999999997 18.55 22.325 38.7 4 23.25 25.724999999999998 18.675 32.35 5 36.325 24.425 11.924999999999999 27.325 6 21.3 31.624999999999996 22.7 24.375 7 14.75 22.675 41.65 20.925 8 19.325 20.150000000000002 34.775 25.75 9 18.025 18.925 38.224999999999994 24.825 10 18.975 33.550000000000004 23.25 24.224999999999998 11 24.725 26.375 22.375 26.525 12 23.825 23.674999999999997 26.05 26.450000000000003 13 22.125 26.625 23.525 27.725 14 19.35 24.45 29.2 27.0 15 20.65 24.025 30.075000000000003 25.25 16 20.825 24.725 27.35 27.1 17 22.025 25.224999999999998 28.249999999999996 24.5 18 20.825 26.825 26.525 25.825 19 22.025 27.224999999999998 23.849999999999998 26.900000000000002 20 23.05 24.7 24.725 27.525 21 19.950000000000003 24.349999999999998 28.225 27.474999999999998 22 21.075 25.924999999999997 26.474999999999998 26.525 23 22.175 26.85 27.625 23.35 24 23.724999999999998 24.75 25.874999999999996 25.650000000000002 25 21.375 26.875 24.65 27.1 26 21.325 27.1 25.55 26.025 27 24.25 30.525000000000002 21.0 24.224999999999998 28 20.825 29.175 25.825 24.175 29 20.775 28.775000000000002 25.874999999999996 24.575 30 20.150000000000002 25.900000000000002 28.375 25.575 31 22.900000000000002 28.65 24.825 23.625 32 21.775 30.25 23.200000000000003 24.775 33 20.325 28.575 26.05 25.05 34 22.225 24.975 24.9 27.900000000000002 35 23.875 29.4 20.474999999999998 26.25 36 20.875 29.325000000000003 22.25 27.55 37 21.125 29.925 24.425 24.525 38 22.775000000000002 28.9 22.975 25.35 39 22.175 27.375 24.224999999999998 26.224999999999998 40 22.05 28.849999999999998 21.2 27.900000000000002 41 22.425 25.674999999999997 23.075000000000003 28.825 42 20.8 24.0 26.6 28.599999999999998 43 24.65 24.85 23.549999999999997 26.950000000000003 44 22.3 26.275 24.0 27.425 45 22.15 27.425 24.4 26.025 46 24.125 24.85 23.3 27.725 47 25.074999999999996 26.125 23.05 25.75 48 22.575 27.775 23.150000000000002 26.5 49 21.6 26.0 21.975 30.425 50 23.275000000000002 26.950000000000003 22.325 27.450000000000003 51 24.55 27.525 22.25 25.674999999999997 52 24.525 30.049999999999997 21.075 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 3.0 19 4.0 20 5.0 21 6.0 22 6.0 23 6.0 24 9.0 25 12.0 26 17.5 27 23.0 28 30.0 29 37.0 30 46.0 31 55.0 32 61.0 33 67.0 34 101.5 35 136.0 36 146.5 37 157.0 38 185.5 39 219.5 40 225.0 41 226.5 42 228.0 43 259.5 44 291.0 45 296.0 46 301.0 47 297.0 48 293.0 49 293.0 50 293.0 51 276.0 52 259.0 53 262.0 54 265.0 55 235.0 56 205.0 57 211.5 58 218.0 59 197.5 60 177.0 61 150.5 62 124.0 63 111.5 64 83.5 65 68.0 66 57.5 67 47.0 68 56.0 69 65.0 70 49.0 71 33.0 72 32.5 73 32.0 74 27.5 75 23.0 76 17.5 77 12.0 78 8.0 79 4.0 80 5.5 81 7.0 82 8.5 83 10.0 84 5.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70755195134313 97.375 2 1.2164216928535225 2.4 3 0.07602635580334516 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra Rejected 8284 READS because READLEN < 1 Read 8284 spots for SRR5423408.sra Written 8284 spots for SRR5423408.sra Rejected 8273 READS because READLEN < 1 Read 8273 spots for SRR5423408.sra Written 8273 spots for SRR5423408.sra SRR ids: ['SRR5423408.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_znhi_nd1 SRR5423408.sra spots: 165471 blocks: [[1, 8273], [8274, 16546], [16547, 24819], [24820, 33092], [33093, 41365], [41366, 49638], [49639, 57911], [57912, 66184], [66185, 74457], [74458, 82730], [82731, 91003], [91004, 99276], [99277, 107549], [107550, 115822], [115823, 124095], [124096, 132368], [132369, 140641], [140642, 148914], [148915, 157187], [157188, 165471]] SRR5423408 file size 23053 SRR5423408 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423408 SRR5423408_1.fastq Input file: SRR5423408_1.fastq trimmed: SRR5423408-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 06:20:37 2025 >> started Thu Feb 13 06:20:37 2025 >> done (0.108s) 165471 reads processed; of these: 10 ( 0.01%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 165461 (99.99%) reads available; of these: 35522 (21.47%) trimmed reads available after processing 129939 (78.53%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 36 1 0.00% 37 0 0.00% 38 1 0.00% 39 3 0.00% 40 0 0.00% 41 2 0.00% 42 5 0.00% 43 17 0.01% 44 22 0.01% 45 57 0.03% 46 109 0.07% 47 264 0.16% 48 708 0.43% 49 1785 1.08% 50 6518 3.94% 51 26030 15.73% 52 129939 78.53% 165461 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=4 prefix-density=0.32 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=32 fanout-score=4.62 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=1.0 sequence=TCTCGTAGTTCTTGGTCTGTGAAGATACGTTGTTAGGTGCTCCATTTTATTTTCCCATTGAGGCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA Started job on | Feb 13 06:20:49 Started mapping on | Feb 13 06:20:49 Finished on | Feb 13 06:20:58 Mapping speed, Million of reads per hour | 66.18 Number of input reads | 165461 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 118020 Uniquely mapped reads % | 71.33% Average mapped length | 51.29 Number of splices: Total | 8899 Number of splices: Annotated (sjdb) | 8780 Number of splices: GT/AG | 8648 Number of splices: GC/AG | 199 Number of splices: AT/AC | 43 Number of splices: Non-canonical | 9 Mismatch rate per base, % | 3.02% Deletion rate per base | 0.01% Deletion average length | 2.92 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 30373 % of reads mapped to multiple loci | 18.36% Number of reads mapped to too many loci | 2031 % of reads mapped to too many loci | 1.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.08% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 17068 17068 17068 N_multimapping 30373 30373 30373 N_noFeature 15662 116462 16767 N_ambiguous 915 1 461 UnstrandedReadsAssigned:101443 PositiveStrandReadsAssigned:1557 NegativeStrandReadsAssigned:100792 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=51 echo kmer=47 SRR5423408 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423408-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 165,461 reads, 83,523 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 742 rounds 52401 SRR5423408.ke.tsv 34699 SRR5423408.se.tsv 87100 total ==> SRR5423408.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2 11.2282 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 0 0 Potri.016G087400.1.v4.1 270 171 4 252.012 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 0 0 ==> SRR5423408.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423408 completed mapping pipeline successfully