Starting /dee2/code/volunteer_pipeline.sh SRR5423417 current disk space = 3050948435968 free memory = 1580110464 SRR5423417 SRAfilesize 43be6d25bd8738de7415f80014d6b234 SRR5423417.sra SRR5423417.sra file validated SRR5423417 is single end SRR5423417 is conventional basespace SRR5423417 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423417_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.38525 34.0 31.0 34.0 2.0 34.0 2 30.94825 34.0 31.0 34.0 19.0 34.0 3 32.13225 34.0 31.0 34.0 28.0 34.0 4 35.8275 37.0 35.0 37.0 35.0 37.0 5 35.92875 37.0 35.0 37.0 35.0 37.0 6 35.943 37.0 35.0 37.0 35.0 37.0 7 36.038 37.0 35.0 37.0 35.0 37.0 8 35.997 37.0 35.0 37.0 35.0 37.0 9 37.8495 39.0 38.0 39.0 35.0 39.0 10 37.7395 39.0 38.0 39.0 35.0 39.0 11 37.7845 39.0 38.0 39.0 35.0 39.0 12 37.7765 39.0 38.0 39.0 35.0 39.0 13 37.70125 39.0 38.0 39.0 35.0 39.0 14 39.244 40.0 39.0 41.0 36.0 41.0 15 39.08775 40.0 39.0 41.0 36.0 41.0 16 39.08625 40.0 38.0 41.0 36.0 41.0 17 39.01625 40.0 38.0 41.0 36.0 41.0 18 39.026 40.0 38.0 41.0 36.0 41.0 19 38.91775 40.0 38.0 41.0 35.0 41.0 20 38.9385 40.0 38.0 41.0 35.0 41.0 21 38.884 40.0 38.0 41.0 35.0 41.0 22 38.96975 40.0 39.0 41.0 36.0 41.0 23 38.82075 40.0 38.0 41.0 35.0 41.0 24 38.71425 40.0 38.0 41.0 34.0 41.0 25 38.57725 40.0 38.0 41.0 34.0 41.0 26 38.55975 40.0 38.0 41.0 34.0 41.0 27 38.62925 40.0 38.0 41.0 34.0 41.0 28 38.448 40.0 38.0 41.0 34.0 41.0 29 38.5325 40.0 38.0 41.0 34.0 41.0 30 38.47575 40.0 38.0 41.0 34.0 41.0 31 38.31525 40.0 38.0 41.0 34.0 41.0 32 38.02325 40.0 38.0 41.0 33.0 41.0 33 38.1135 40.0 38.0 41.0 33.0 41.0 34 38.06025 40.0 38.0 41.0 33.0 41.0 35 38.0325 40.0 38.0 41.0 33.0 41.0 36 37.85075 40.0 38.0 41.0 33.0 41.0 37 37.7645 40.0 38.0 41.0 32.0 41.0 38 37.71325 40.0 38.0 41.0 32.0 41.0 39 37.67975 40.0 37.0 41.0 32.0 41.0 40 37.631 40.0 37.0 41.0 32.0 41.0 41 37.6595 40.0 37.0 41.0 32.0 41.0 42 37.46875 40.0 37.0 41.0 31.0 41.0 43 37.4545 40.0 37.0 41.0 31.0 41.0 44 37.3145 40.0 37.0 41.0 31.0 41.0 45 37.08325 40.0 37.0 41.0 30.0 41.0 46 37.02825 40.0 37.0 41.0 31.0 41.0 47 36.82025 40.0 36.0 41.0 30.0 41.0 48 36.82 40.0 36.0 41.0 30.0 41.0 49 36.88775 40.0 36.0 41.0 30.0 41.0 50 36.8725 40.0 36.0 41.0 30.0 41.0 51 36.62225 39.0 36.0 41.0 29.0 41.0 52 34.531 38.0 33.0 40.0 24.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 3.0 21 2.0 22 6.0 23 11.0 24 8.0 25 20.0 26 15.0 27 21.0 28 32.0 29 38.0 30 71.0 31 63.0 32 84.0 33 114.0 34 159.0 35 212.0 36 307.0 37 435.0 38 807.0 39 1585.0 40 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.96351991088833 9.663046505151767 5.179615705931495 44.193817878028405 2 23.1 13.425 36.375 27.1 3 21.425 16.650000000000002 23.75 38.175 4 26.450000000000003 25.224999999999998 20.474999999999998 27.85 5 23.625 31.874999999999996 22.675 21.825 6 18.725 33.900000000000006 23.525 23.849999999999998 7 14.499999999999998 24.375 41.85 19.275000000000002 8 16.925 23.775 30.15 29.15 9 17.8 21.15 32.625 28.425 10 18.575 37.675 24.9 18.85 11 23.599999999999998 29.075 21.125 26.200000000000003 12 20.875 24.175 26.650000000000002 28.299999999999997 13 20.599999999999998 27.125 28.025 24.25 14 19.900000000000002 28.849999999999998 27.875 23.375 15 20.875 25.974999999999998 26.974999999999998 26.174999999999997 16 20.349999999999998 27.275 27.375 25.0 17 21.775 28.449999999999996 26.825 22.95 18 21.3 26.85 25.7 26.150000000000002 19 21.349999999999998 28.000000000000004 25.3 25.35 20 21.025 27.425 26.825 24.725 21 21.099999999999998 26.700000000000003 26.325 25.874999999999996 22 21.349999999999998 26.55 25.6 26.5 23 21.25 28.375 25.324999999999996 25.05 24 20.974999999999998 26.700000000000003 26.325 26.0 25 20.9 27.474999999999998 27.025 24.6 26 21.875 27.500000000000004 26.5 24.125 27 20.25 27.125 25.924999999999997 26.700000000000003 28 21.15 28.725 25.924999999999997 24.2 29 21.275 29.75 25.775 23.200000000000003 30 20.825 27.425 25.424999999999997 26.325 31 21.05 28.125 25.724999999999998 25.1 32 20.474999999999998 27.125 26.775 25.624999999999996 33 20.474999999999998 26.3 27.625 25.6 34 20.075000000000003 27.975 25.874999999999996 26.075 35 19.8 28.249999999999996 25.2 26.75 36 21.675 26.224999999999998 25.2 26.900000000000002 37 22.55 26.25 25.724999999999998 25.474999999999998 38 22.95 26.75 25.3 25.0 39 21.125 24.9 27.175 26.8 40 19.900000000000002 27.200000000000003 25.624999999999996 27.275 41 21.425 26.450000000000003 25.6 26.525 42 21.0 25.45 26.224999999999998 27.325 43 21.95 27.05 25.4 25.6 44 22.225 27.450000000000003 26.075 24.25 45 21.725 26.6 25.3 26.375 46 23.225 26.25 24.575 25.95 47 22.15 27.650000000000002 25.25 24.95 48 21.9 26.724999999999998 25.55 25.825 49 21.975 26.474999999999998 24.375 27.175 50 22.900000000000002 27.224999999999998 25.474999999999998 24.4 51 23.0 26.0 24.175 26.825 52 23.225 27.500000000000004 24.125 25.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 2.0 18 2.5 19 3.0 20 5.0 21 7.0 22 8.0 23 9.0 24 10.0 25 11.0 26 19.0 27 27.0 28 32.5 29 38.0 30 51.0 31 64.0 32 69.0 33 74.0 34 84.5 35 95.0 36 138.0 37 181.0 38 205.5 39 234.0 40 238.0 41 254.5 42 271.0 43 303.5 44 336.0 45 330.5 46 325.0 47 330.0 48 335.0 49 326.0 50 317.0 51 318.0 52 319.0 53 316.5 54 314.0 55 275.5 56 237.0 57 200.5 58 164.0 59 148.5 60 133.0 61 116.5 62 100.0 63 84.5 64 55.5 65 42.0 66 31.5 67 21.0 68 17.5 69 14.0 70 13.0 71 12.0 72 8.5 73 5.0 74 3.5 75 2.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.48256931100741 86.05000000000001 2 3.7331869338457313 6.800000000000001 3 0.9058468295360966 2.475 4 0.3568487510293714 1.3 5 0.21959923140269008 1.0 6 0.08234971177600879 0.44999999999999996 7 0.05489980785067252 0.35000000000000003 8 0.02744990392533626 0.2 9 0.05489980785067252 0.44999999999999996 >10 0.08234971177600879 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 14 0.35000000000000003 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 13 0.325 No Hit GTGCATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGTA 10 0.25 No Hit GCCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTAC 9 0.22499999999999998 No Hit GTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCC 9 0.22499999999999998 No Hit CCCTGATCAAACTAGAGGTTACCAAAGAACCATGCATAGCACTGAATAGGGA 8 0.2 No Hit GTCCCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAAC 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 7 0.17500000000000002 No Hit CGCAGAAGTAGGAATAATGGCACCAGAAATGATATTGTTTCCATAAAGTAGA 6 0.15 No Hit CACGGTTAATAATATCAGCCCAGGTATTAATTACACGACCTTGACTATCAAC 6 0.15 No Hit CTCAGCCTGGAATACAATCATAAAGTTAAAAGTACCAGAGATTCCTAGAGGC 6 0.15 No Hit GGTGCATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGT 5 0.125 No Hit GTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCG 5 0.125 No Hit CGCCGCAACAGGAGCTGAATATGCAACAGCAATCCAAGGACGCATACCCAGA 5 0.125 No Hit GTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCA 5 0.125 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 5 0.125 No Hit CTGGAATACAATCATAAAGTTAAAAGTACCAGAGATTCCTAGAGGCATCCCA 5 0.125 No Hit CTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGCA 5 0.125 No Hit CTCCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra Read 200000 spots for SRR5423417.sra Written 200000 spots for SRR5423417.sra SRR ids: ['SRR5423417.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wy2t79ax SRR5423417.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423417 file size 703968 SRR5423417 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423417 SRR5423417_1.fastq Input file: SRR5423417_1.fastq trimmed: SRR5423417-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 10:24:40 2025 >> started Wed Feb 12 10:24:43 2025 >> done (2.799s) 4000000 reads processed; of these: 142 ( 0.00%) short reads filtered out after trimming by size control 87 ( 0.00%) empty reads filtered out after trimming by size control 3999771 (99.99%) reads available; of these: 107404 ( 2.69%) trimmed reads available after processing 3892367 (97.31%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 6 0.00% 20 3 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 5 0.00% 25 9 0.00% 26 5 0.00% 27 5 0.00% 28 4 0.00% 29 3 0.00% 30 8 0.00% 31 8 0.00% 32 10 0.00% 33 24 0.00% 34 25 0.00% 35 28 0.00% 36 42 0.00% 37 38 0.00% 38 53 0.00% 39 93 0.00% 40 104 0.00% 41 131 0.00% 42 189 0.00% 43 218 0.01% 44 404 0.01% 45 566 0.01% 46 691 0.02% 47 1105 0.03% 48 2102 0.05% 49 4655 0.12% 50 13168 0.33% 51 83687 2.09% 52 3892367 97.31% 3999771 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.47 prefix-fanout=2.0 sequence=TGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=24.97 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=1.2 sequence=CATTTTATTTCTATCTTTCCATACATAACCAAAAAATGGAAAAGATTCTTCAAGAGTCTCGGGTCCTAGAAGTGCATGATAAATACCGCCAAAGCCCAATACTGCAGAGGAAATTAAGTGAAGTACGCCAGATACAAAGTATGGAAAGGTGTCTATGACTTCCCCGCCAGGACCCACCCCCCAACCTAGAGTAGCTAGGTGGGGAAGTAAAATTAATCCTTGTTCATACATTGGCTTCTCCGGTACGAAATGGGCCACTTCAAATAGGTTCATTGCTCCGGCCCAGAATACGATTAATCCAGCATGGGCTACATGAGCTCCCAGCAGTT Started job on | Feb 12 10:24:56 Started mapping on | Feb 12 10:24:56 Finished on | Feb 12 10:25:01 Mapping speed, Million of reads per hour | 2879.84 Number of input reads | 3999771 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3135216 Uniquely mapped reads % | 78.38% Average mapped length | 51.77 Number of splices: Total | 288394 Number of splices: Annotated (sjdb) | 283796 Number of splices: GT/AG | 281705 Number of splices: GC/AG | 5409 Number of splices: AT/AC | 762 Number of splices: Non-canonical | 518 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 714197 % of reads mapped to multiple loci | 17.86% Number of reads mapped to too many loci | 80139 % of reads mapped to too many loci | 2.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 150358 150358 150358 N_multimapping 714197 714197 714197 N_noFeature 394629 3089513 428834 N_ambiguous 22287 173 10625 UnstrandedReadsAssigned:2718300 PositiveStrandReadsAssigned:45530 NegativeStrandReadsAssigned:2695757 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423417 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423417-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,771 reads, 3,281,348 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR5423417.ke.tsv 34699 SRR5423417.se.tsv 87100 total ==> SRR5423417.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 145 21.2727 Potri.005G024800.1.v4.1 1035 936 13 3.91018 Potri.004G059700.1.v4.1 961 862 2 0.653209 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 47.555 4.70756 Potri.016G087400.1.v4.1 270 171 12 19.7567 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.16818 Potri.012G127500.1.v4.1 977 878 6 1.92392 ==> SRR5423417.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 34 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423417 completed mapping pipeline successfully