Starting /dee2/code/volunteer_pipeline.sh SRR5423418 current disk space = 3052673748992 free memory = 1426487680 SRR5423418 SRAfilesize 7c87c7a9ffb990c6ba0df12f829275e2 SRR5423418.sra SRR5423418.sra file validated SRR5423418 is single end SRR5423418 is conventional basespace SRR5423418 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423418_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.006 34.0 31.0 34.0 26.0 34.0 2 31.29775 34.0 31.0 34.0 26.0 34.0 3 32.28 34.0 31.0 34.0 28.0 34.0 4 35.87175 37.0 35.0 37.0 35.0 37.0 5 35.9745 37.0 35.0 37.0 35.0 37.0 6 36.02775 37.0 35.0 37.0 35.0 37.0 7 36.08175 37.0 35.0 37.0 35.0 37.0 8 36.06575 37.0 35.0 37.0 35.0 37.0 9 37.7515 39.0 38.0 39.0 35.0 39.0 10 37.51475 39.0 37.0 39.0 35.0 39.0 11 37.73975 39.0 38.0 39.0 35.0 39.0 12 37.73225 39.0 38.0 39.0 35.0 39.0 13 37.76475 39.0 38.0 39.0 35.0 39.0 14 39.14275 40.0 39.0 41.0 36.0 41.0 15 39.039 40.0 38.0 41.0 35.0 41.0 16 39.06675 40.0 38.0 41.0 36.0 41.0 17 39.04975 40.0 38.0 41.0 36.0 41.0 18 38.993 40.0 38.0 41.0 35.0 41.0 19 39.014 40.0 38.0 41.0 36.0 41.0 20 38.82575 40.0 38.0 41.0 34.0 41.0 21 38.896 40.0 39.0 41.0 35.0 41.0 22 38.8405 40.0 38.0 41.0 35.0 41.0 23 38.81925 40.0 38.0 41.0 34.0 41.0 24 38.745 40.0 38.0 41.0 34.0 41.0 25 38.69925 40.0 38.0 41.0 34.0 41.0 26 38.58775 40.0 38.0 41.0 34.0 41.0 27 38.488 40.0 38.0 41.0 34.0 41.0 28 38.453 40.0 38.0 41.0 34.0 41.0 29 38.4985 40.0 38.0 41.0 34.0 41.0 30 38.41175 40.0 38.0 41.0 34.0 41.0 31 38.2215 40.0 38.0 41.0 34.0 41.0 32 38.2025 40.0 38.0 41.0 33.0 41.0 33 38.211 40.0 38.0 41.0 34.0 41.0 34 38.219 40.0 38.0 41.0 34.0 41.0 35 38.18325 40.0 38.0 41.0 34.0 41.0 36 38.131 40.0 38.0 41.0 34.0 41.0 37 37.906 40.0 38.0 41.0 33.0 41.0 38 37.82925 40.0 38.0 41.0 33.0 41.0 39 37.84925 40.0 38.0 41.0 33.0 41.0 40 37.7885 40.0 38.0 41.0 32.0 41.0 41 37.64625 40.0 38.0 41.0 32.0 41.0 42 37.492 40.0 37.0 41.0 31.0 41.0 43 37.399 40.0 37.0 41.0 31.0 41.0 44 37.35325 40.0 37.0 41.0 31.0 41.0 45 37.3495 40.0 37.0 41.0 31.0 41.0 46 36.93075 40.0 36.0 41.0 30.0 41.0 47 36.931 40.0 36.0 41.0 30.0 41.0 48 36.97725 40.0 36.0 41.0 30.0 41.0 49 36.7825 40.0 36.0 41.0 30.0 41.0 50 36.81475 40.0 36.0 41.0 30.0 41.0 51 36.67875 39.0 36.0 41.0 29.0 41.0 52 34.75375 38.0 33.0 40.0 24.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 1.0 20 1.0 21 8.0 22 12.0 23 5.0 24 11.0 25 12.0 26 19.0 27 16.0 28 39.0 29 41.0 30 62.0 31 64.0 32 90.0 33 106.0 34 152.0 35 189.0 36 272.0 37 425.0 38 830.0 39 1639.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.05438644438371 10.194042088002186 5.5479639245695545 45.20360754304455 2 22.675 14.000000000000002 35.3 28.025 3 22.2 17.1 22.8 37.9 4 25.45 25.55 20.875 28.125 5 25.224999999999998 31.2 22.975 20.599999999999998 6 19.175 33.25 23.674999999999997 23.9 7 14.875 23.325000000000003 41.275 20.525 8 17.724999999999998 23.35 30.125 28.799999999999997 9 18.625 20.25 34.25 26.875 10 18.224999999999998 37.05 24.75 19.975 11 23.400000000000002 28.975 21.825 25.8 12 22.55 23.599999999999998 26.474999999999998 27.375 13 18.65 28.775000000000002 27.125 25.45 14 21.175 28.025 28.15 22.650000000000002 15 21.975 25.974999999999998 26.450000000000003 25.6 16 21.45 26.174999999999997 27.05 25.324999999999996 17 21.325 26.424999999999997 27.35 24.9 18 21.95 26.5 26.174999999999997 25.374999999999996 19 20.9 28.249999999999996 25.7 25.15 20 21.25 26.5 26.825 25.424999999999997 21 21.45 26.375 26.424999999999997 25.75 22 20.775 28.599999999999998 24.5 26.125 23 21.825 28.449999999999996 24.0 25.724999999999998 24 22.525000000000002 26.075 25.8 25.6 25 21.325 25.525 27.150000000000002 26.0 26 22.275 25.974999999999998 27.1 24.65 27 19.975 27.125 26.875 26.025 28 21.25 26.125 27.474999999999998 25.15 29 21.325 27.500000000000004 28.525 22.650000000000002 30 21.775 25.074999999999996 27.950000000000003 25.2 31 21.4 27.1 26.075 25.424999999999997 32 21.825 27.6 25.3 25.275 33 21.3 25.35 27.625 25.724999999999998 34 21.7 26.950000000000003 25.674999999999997 25.674999999999997 35 21.5 26.974999999999998 25.974999999999998 25.55 36 21.8 26.174999999999997 26.224999999999998 25.8 37 21.975 27.224999999999998 24.0 26.8 38 21.175 25.900000000000002 25.8 27.125 39 20.925 26.674999999999997 26.525 25.874999999999996 40 21.6 26.450000000000003 25.825 26.125 41 21.8 27.05 25.474999999999998 25.674999999999997 42 21.349999999999998 25.5 26.400000000000002 26.75 43 21.375 27.224999999999998 25.324999999999996 26.075 44 21.55 27.650000000000002 26.724999999999998 24.075 45 23.7 24.725 25.374999999999996 26.200000000000003 46 22.3 27.05 24.625 26.025 47 21.55 27.224999999999998 24.825 26.400000000000002 48 22.075 25.3 24.3 28.325 49 22.7 25.95 23.724999999999998 27.625 50 22.425 27.175 24.425 25.974999999999998 51 21.6 25.924999999999997 26.474999999999998 26.0 52 22.525000000000002 26.05 24.85 26.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 3.0 18 2.5 19 2.0 20 3.0 21 4.0 22 5.5 23 7.0 24 8.0 25 9.0 26 15.5 27 22.0 28 26.5 29 31.0 30 37.0 31 43.0 32 72.5 33 102.0 34 102.5 35 103.0 36 135.0 37 167.0 38 192.5 39 225.5 40 233.0 41 256.0 42 279.0 43 291.5 44 304.0 45 318.0 46 332.0 47 319.5 48 307.0 49 314.5 50 322.0 51 335.5 52 349.0 53 337.5 54 326.0 55 281.5 56 237.0 57 206.5 58 176.0 59 162.5 60 149.0 61 134.5 62 120.0 63 89.0 64 46.0 65 34.0 66 29.5 67 25.0 68 20.0 69 15.0 70 11.0 71 7.0 72 8.0 73 9.0 74 5.5 75 2.0 76 1.5 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 1.0 83 2.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.05091311566132 84.975 2 3.901494189263974 7.049999999999999 3 1.0514665190924184 2.85 4 0.4980630879911455 1.7999999999999998 5 0.1936912008854455 0.8750000000000001 6 0.11068068622025456 0.6 7 0.02767017155506364 0.17500000000000002 8 0.02767017155506364 0.2 9 0.05534034311012728 0.44999999999999996 >10 0.08301051466519092 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 16 0.4 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 14 0.35000000000000003 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 11 0.27499999999999997 No Hit GTGCATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGTA 9 0.22499999999999998 No Hit GCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAGATCA 9 0.22499999999999998 No Hit CTCGTACACACTAAGAAAAAAGCCTTATCCATTTACAAAAGTCTTATCCATT 8 0.2 No Hit GTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCC 7 0.17500000000000002 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 6 0.15 No Hit GTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGTACCAGAGATTCCTAGA 6 0.15 No Hit CTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGCA 6 0.15 No Hit GCCGCTTCCCATATTGGGTAAAAGTGCAACCCTATAGCCGCAGAAGTAGGAA 6 0.15 No Hit CGCAGAAGTAGGAATAATGGCACCAGAAATGATATTGTTTCCATAAAGTAGA 5 0.125 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit GCCCCATGTAACAAGCTACACCAAGTAAGAAGTGTAGAACAATTAGCTCATA 5 0.125 No Hit CACGGTTAATAATATCAGCCCAGGTATTAATTACACGACCTTGACTATCAAC 5 0.125 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 5 0.125 No Hit GTTAAAACTAGCATATTGGAAGATCAATCGGCCAAAATAACCATGAGCGGCT 5 0.125 No Hit CTCAGCCTGGAATACAATCATAAAGTTAAAAGTACCAGAGATTCCTAGAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra Read 200000 spots for SRR5423418.sra Written 200000 spots for SRR5423418.sra SRR ids: ['SRR5423418.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_532usoe5 SRR5423418.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423418 file size 703962 SRR5423418 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423418 SRR5423418_1.fastq Input file: SRR5423418_1.fastq trimmed: SRR5423418-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 07:23:54 2025 >> started Thu Feb 13 07:23:56 2025 >> done (1.844s) 4000000 reads processed; of these: 137 ( 0.00%) short reads filtered out after trimming by size control 81 ( 0.00%) empty reads filtered out after trimming by size control 3999782 (99.99%) reads available; of these: 86165 ( 2.15%) trimmed reads available after processing 3913617 (97.85%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 2 0.00% 20 3 0.00% 21 0 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 3 0.00% 26 1 0.00% 27 8 0.00% 28 11 0.00% 29 6 0.00% 30 5 0.00% 31 7 0.00% 32 7 0.00% 33 14 0.00% 34 20 0.00% 35 32 0.00% 36 15 0.00% 37 34 0.00% 38 30 0.00% 39 52 0.00% 40 66 0.00% 41 94 0.00% 42 134 0.00% 43 124 0.00% 44 309 0.01% 45 415 0.01% 46 591 0.01% 47 831 0.02% 48 1459 0.04% 49 3534 0.09% 50 10534 0.26% 51 67804 1.70% 52 3913617 97.85% 3999782 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=0.47 prefix-fanout=2.0 sequence=TGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=25.87 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=1.2 sequence=CATTTTATTTCTATCTTTCCATACATAACCAAAAAATGGAAAAGATTCTTCAAGAGTCTCGGGTCCTAGAAGTGCATGATAAATACCGCCAAAGCCCAATACTGCAGAGGAAATTAAGTGAAGTACGCCAGATACAAAGTATGGAAAGGTGTCTATGACTTCCCCGCCAGGACCCACCCCCCAACCTAGAGTAGCTAGGTGGGGAAGTAAAATTAATCCTTGTTCATACATTGGCTTCTCCGGTACGAAATGGGCCACTTCAAATAGGTTCATTGCTCCGGCCCAGAATACGATTAATCCAGCATGGGCTACATGAGCTCCCAGCAG Started job on | Feb 13 07:24:08 Started mapping on | Feb 13 07:24:09 Finished on | Feb 13 07:24:13 Mapping speed, Million of reads per hour | 3599.80 Number of input reads | 3999782 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3137088 Uniquely mapped reads % | 78.43% Average mapped length | 51.79 Number of splices: Total | 288646 Number of splices: Annotated (sjdb) | 284002 Number of splices: GT/AG | 281947 Number of splices: GC/AG | 5427 Number of splices: AT/AC | 750 Number of splices: Non-canonical | 522 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 711399 % of reads mapped to multiple loci | 17.79% Number of reads mapped to too many loci | 82028 % of reads mapped to too many loci | 2.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.72% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 151295 151295 151295 N_multimapping 711399 711399 711399 N_noFeature 394135 3091578 428290 N_ambiguous 22081 152 10585 UnstrandedReadsAssigned:2720872 PositiveStrandReadsAssigned:45358 NegativeStrandReadsAssigned:2698213 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423418 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423418-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,782 reads, 3,286,169 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR5423418.ke.tsv 34699 SRR5423418.se.tsv 87100 total ==> SRR5423418.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 142 20.7172 Potri.005G024800.1.v4.1 1035 936 19 5.68323 Potri.004G059700.1.v4.1 961 862 6 1.94877 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 44.4998 4.38073 Potri.016G087400.1.v4.1 270 171 14 22.9218 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 2 0.637753 ==> SRR5423418.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 33 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423418 completed mapping pipeline successfully