Starting /dee2/code/volunteer_pipeline.sh SRR5423427 current disk space = 3049601224704 free memory = 1299661712 SRR5423427 SRAfilesize 3172bee3a3c67a12b0117189091216f8 SRR5423427.sra SRR5423427.sra file validated SRR5423427 is single end SRR5423427 is conventional basespace SRR5423427 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423427_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.79625 16.0 16.0 27.0 16.0 30.0 2 23.04675 25.0 16.0 30.0 16.0 30.0 3 24.3 27.0 16.0 30.0 16.0 31.0 4 29.31975 32.0 25.0 35.0 19.0 35.0 5 23.34125 19.0 19.0 32.0 10.0 35.0 6 22.2805 17.0 17.0 31.0 10.0 33.0 7 23.36375 25.0 17.0 32.0 10.0 33.0 8 24.591 28.0 17.0 32.0 11.0 35.0 9 24.2895 27.0 17.0 32.0 10.0 35.0 10 26.463 28.0 17.0 34.0 15.0 35.0 11 27.25475 30.0 18.0 34.0 15.0 35.0 12 26.2415 27.0 17.0 34.0 11.0 35.0 13 26.477 30.0 17.0 34.0 11.0 35.0 14 27.38575 31.0 19.0 34.0 11.0 37.0 15 28.042 31.0 25.0 34.0 16.0 37.0 16 28.07275 32.0 25.0 34.0 16.0 37.0 17 28.22525 31.0 25.0 34.0 16.0 37.0 18 24.92875 27.0 17.0 32.0 10.0 36.0 19 26.554 27.0 18.0 34.0 10.0 37.0 20 26.089 27.0 18.0 34.0 10.0 37.0 21 26.74325 29.0 19.0 34.0 10.0 37.0 22 26.68375 30.0 18.0 34.0 10.0 37.0 23 25.48175 27.0 18.0 34.0 10.0 37.0 24 25.49975 27.0 18.0 33.0 10.0 36.0 25 24.279 27.0 17.0 32.0 10.0 36.0 26 21.05575 19.0 10.0 30.0 9.0 34.0 27 21.1755 21.0 10.0 30.0 9.0 34.0 28 21.723 24.0 10.0 30.0 8.0 34.0 29 22.58725 25.0 15.0 31.0 9.0 35.0 30 23.03575 25.0 15.0 32.0 9.0 35.0 31 23.32125 25.0 15.0 32.0 9.0 35.0 32 18.725 16.0 9.0 27.0 8.0 33.0 33 19.95 17.0 9.0 30.0 8.0 34.0 34 21.653 24.0 14.0 30.0 8.0 34.0 35 21.6495 24.0 10.0 30.0 8.0 35.0 36 20.33525 19.0 9.0 30.0 8.0 34.0 37 20.16575 19.0 9.0 30.0 8.0 34.0 38 19.71475 18.0 9.0 30.0 8.0 34.0 39 20.66375 22.0 9.0 30.0 8.0 34.0 40 20.5775 22.0 9.0 30.0 8.0 34.0 41 21.71025 24.0 13.0 30.0 8.0 34.0 42 20.71225 23.0 9.0 30.0 8.0 34.0 43 21.04375 23.0 11.0 30.0 8.0 34.0 44 21.29425 23.0 11.0 30.0 8.0 34.0 45 20.57125 22.0 9.0 30.0 8.0 34.0 46 19.84725 20.0 9.0 30.0 8.0 33.0 47 19.76525 20.0 9.0 29.0 8.0 33.0 48 20.15375 22.0 9.0 30.0 7.0 33.0 49 18.9 18.0 9.0 28.0 7.0 33.0 50 18.9915 19.0 9.0 28.0 7.0 33.0 51 16.5545 13.0 8.0 24.0 7.0 31.0 52 16.646 14.0 8.0 24.0 7.0 30.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 2.0 14 11.0 15 36.0 16 61.0 17 112.0 18 191.0 19 309.0 20 340.0 21 443.0 22 475.0 23 522.0 24 474.0 25 326.0 26 313.0 27 190.0 28 108.0 29 61.0 30 17.0 31 4.0 32 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.7 12.8 5.875 44.625 2 23.400000000000002 12.8 36.25 27.55 3 17.299999999999997 17.925 26.950000000000003 37.824999999999996 4 21.025 26.825 22.400000000000002 29.75 5 38.2 23.25 10.674999999999999 27.875 6 19.225 29.599999999999998 24.05 27.125 7 15.775 21.25 41.099999999999994 21.875 8 17.775 21.625 30.85 29.75 9 20.025000000000002 19.375 34.325 26.275 10 19.625 30.925000000000004 26.950000000000003 22.5 11 24.099999999999998 23.724999999999998 22.875 29.299999999999997 12 21.75 22.15 26.525 29.575000000000003 13 20.825 24.725 29.9 24.55 14 20.375 25.650000000000002 26.075 27.900000000000002 15 21.224999999999998 23.95 27.950000000000003 26.875 16 21.3 21.85 28.175 28.675 17 19.85 24.5 25.724999999999998 29.925 18 20.25 27.1 26.55 26.1 19 20.125 26.0 26.05 27.825 20 21.925 25.75 25.55 26.775 21 21.5 23.599999999999998 27.575 27.325 22 19.85 28.075 22.7 29.375 23 21.075 26.075 24.95 27.900000000000002 24 20.05 28.999999999999996 25.275 25.674999999999997 25 20.849999999999998 26.724999999999998 26.650000000000002 25.775 26 22.900000000000002 28.025 24.925 24.15 27 22.825 23.3 26.950000000000003 26.924999999999997 28 24.125 28.749999999999996 23.849999999999998 23.275000000000002 29 23.0 26.450000000000003 27.275 23.275000000000002 30 19.400000000000002 26.174999999999997 26.525 27.900000000000002 31 21.55 27.500000000000004 25.124999999999996 25.825 32 23.625 26.625 24.75 25.0 33 21.7 24.175 27.0 27.125 34 21.425 22.725 26.525 29.325000000000003 35 23.625 28.925 23.150000000000002 24.3 36 20.275000000000002 26.650000000000002 24.775 28.299999999999997 37 24.05 29.349999999999998 22.825 23.775 38 19.25 28.199999999999996 25.55 27.0 39 23.7 25.1 21.9 29.299999999999997 40 23.925 25.124999999999996 22.0 28.95 41 21.55 25.124999999999996 24.325 28.999999999999996 42 21.5 24.275 27.075 27.150000000000002 43 22.825 24.0 25.924999999999997 27.250000000000004 44 24.85621405351338 25.85646411602901 23.730932733183295 25.55638909727432 45 21.425 24.55 25.85 28.175 46 22.625 25.124999999999996 25.0 27.250000000000004 47 23.055763940985248 27.156789197299325 23.40585146286572 26.38159539884971 48 22.98649324662331 25.71285642821411 23.186593296648326 28.114057028514257 49 23.080770192548137 25.55638909727432 22.80570142535634 28.557139284821204 50 22.73068267066767 27.506876719179797 23.58089522380595 26.18154538634659 51 21.475 28.775000000000002 22.725 27.025 52 22.475 26.75 23.9 26.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 2.0 15 3.0 16 1.5 17 0.0 18 1.5 19 3.0 20 6.0 21 9.0 22 8.5 23 8.0 24 9.5 25 11.0 26 19.0 27 27.0 28 33.0 29 39.0 30 46.5 31 54.0 32 64.0 33 74.0 34 91.0 35 108.0 36 128.0 37 148.0 38 160.5 39 196.5 40 220.0 41 239.0 42 258.0 43 262.5 44 267.0 45 267.5 46 268.0 47 283.5 48 299.0 49 317.0 50 335.0 51 312.5 52 290.0 53 278.5 54 267.0 55 239.5 56 212.0 57 196.0 58 180.0 59 164.0 60 148.0 61 136.5 62 125.0 63 115.0 64 87.0 65 69.0 66 72.0 67 75.0 68 65.0 69 55.0 70 48.0 71 41.0 72 38.5 73 36.0 74 29.5 75 23.0 76 24.5 77 26.0 78 20.0 79 14.0 80 13.5 81 13.0 82 9.5 83 6.0 84 4.5 85 3.0 86 2.0 87 1.0 88 2.5 89 2.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.025 45 0.0 46 0.0 47 0.025 48 0.05 49 0.025 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75729140248541 97.35000000000001 2 1.0398173979203653 2.0500000000000003 3 0.20289119959421759 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9010 READS because READLEN < 1 Read 9010 spots for SRR5423427.sra Written 9010 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra Rejected 9002 READS because READLEN < 1 Read 9002 spots for SRR5423427.sra Written 9002 spots for SRR5423427.sra SRR ids: ['SRR5423427.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cmef35m0 SRR5423427.sra spots: 180048 blocks: [[1, 9002], [9003, 18004], [18005, 27006], [27007, 36008], [36009, 45010], [45011, 54012], [54013, 63014], [63015, 72016], [72017, 81018], [81019, 90020], [90021, 99022], [99023, 108024], [108025, 117026], [117027, 126028], [126029, 135030], [135031, 144032], [144033, 153034], [153035, 162036], [162037, 171038], [171039, 180048]] SRR5423427 file size 25103 SRR5423427 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423427 SRR5423427_1.fastq Input file: SRR5423427_1.fastq trimmed: SRR5423427-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 09:35:51 2025 >> started Wed Feb 12 09:35:51 2025 >> done (0.124s) 180048 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 4 ( 0.00%) empty reads filtered out after trimming by size control 180037 (99.99%) reads available; of these: 38766 (21.53%) trimmed reads available after processing 141271 (78.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 35 2 0.00% 36 2 0.00% 37 0 0.00% 38 1 0.00% 39 3 0.00% 40 2 0.00% 41 4 0.00% 42 5 0.00% 43 12 0.01% 44 29 0.02% 45 52 0.03% 46 125 0.07% 47 295 0.16% 48 718 0.40% 49 2113 1.17% 50 7139 3.97% 51 28264 15.70% 52 141271 78.47% 180037 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=4 prefix-density=0.29 prefix-fanout=1.9 sequence=TGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=24.57 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=1.4 sequence=CAGCAGCTAGGTCTAGAGGGAAATTATGAGCATTACGTTCATGCATAACTTCCATACCAAGGTTAGCACGG Started job on | Feb 12 09:36:04 Started mapping on | Feb 12 09:36:05 Finished on | Feb 12 09:36:14 Mapping speed, Million of reads per hour | 72.01 Number of input reads | 180037 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 124642 Uniquely mapped reads % | 69.23% Average mapped length | 51.27 Number of splices: Total | 9851 Number of splices: Annotated (sjdb) | 9661 Number of splices: GT/AG | 9581 Number of splices: GC/AG | 231 Number of splices: AT/AC | 29 Number of splices: Non-canonical | 10 Mismatch rate per base, % | 3.16% Deletion rate per base | 0.01% Deletion average length | 2.31 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 29854 % of reads mapped to multiple loci | 16.58% Number of reads mapped to too many loci | 3204 % of reads mapped to too many loci | 1.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.40% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 25541 25541 25541 N_multimapping 29854 29854 29854 N_noFeature 15615 122946 16869 N_ambiguous 964 4 518 UnstrandedReadsAssigned:108063 PositiveStrandReadsAssigned:1692 NegativeStrandReadsAssigned:107255 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=51 echo kmer=47 SRR5423427 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423427-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 180,037 reads, 87,113 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 808 rounds 52401 SRR5423427.ke.tsv 34699 SRR5423427.se.tsv 87100 total ==> SRR5423427.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 3 16.0743 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 0 0 Potri.016G087400.1.v4.1 270 171 0 0 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 0 0 ==> SRR5423427.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423427 completed mapping pipeline successfully