Starting /dee2/code/volunteer_pipeline.sh SRR5423435 current disk space = 3051300184064 free memory = 1579183956 SRR5423435 SRAfilesize 35e4f4057cb2d94301ca8171653f840a SRR5423435.sra SRR5423435.sra file validated SRR5423435 is single end SRR5423435 is conventional basespace SRR5423435 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.093 33.0 31.0 34.0 30.0 34.0 2 32.17475 34.0 31.0 34.0 30.0 34.0 3 32.21525 34.0 31.0 34.0 30.0 34.0 4 35.61925 37.0 35.0 37.0 33.0 37.0 5 35.64875 37.0 35.0 37.0 33.0 37.0 6 35.68325 37.0 35.0 37.0 33.0 37.0 7 35.70225 37.0 35.0 37.0 33.0 37.0 8 35.64525 37.0 35.0 37.0 33.0 37.0 9 37.32675 39.0 37.0 39.0 34.0 39.0 10 37.3965 39.0 37.0 39.0 34.0 39.0 11 37.355 39.0 37.0 39.0 34.0 39.0 12 26.7895 35.0 11.0 39.0 10.0 39.0 13 31.84575 35.0 27.0 39.0 17.0 39.0 14 36.17375 37.0 34.0 40.0 31.0 41.0 15 37.52 38.0 36.0 40.0 33.0 41.0 16 38.085 39.0 37.0 40.0 33.0 41.0 17 38.04225 40.0 37.0 41.0 33.0 41.0 18 38.175 40.0 38.0 41.0 33.0 41.0 19 38.53725 40.0 38.0 41.0 34.0 41.0 20 38.52 40.0 38.0 41.0 34.0 41.0 21 38.42725 40.0 38.0 41.0 34.0 41.0 22 38.48875 40.0 38.0 41.0 34.0 41.0 23 38.3265 40.0 38.0 41.0 34.0 41.0 24 38.4105 40.0 38.0 41.0 34.0 41.0 25 38.317 40.0 38.0 41.0 34.0 41.0 26 38.26625 40.0 38.0 41.0 34.0 41.0 27 38.36825 40.0 38.0 41.0 34.0 41.0 28 38.12925 40.0 38.0 41.0 33.0 41.0 29 38.179 40.0 38.0 41.0 33.0 41.0 30 38.149 40.0 38.0 41.0 33.0 41.0 31 38.13275 40.0 38.0 41.0 33.0 41.0 32 38.0085 40.0 37.0 41.0 33.0 41.0 33 37.92375 40.0 37.0 41.0 33.0 41.0 34 38.05125 40.0 37.0 41.0 33.0 41.0 35 38.05775 40.0 38.0 41.0 33.0 41.0 36 37.82125 40.0 37.0 41.0 32.0 41.0 37 37.62425 40.0 37.0 41.0 32.0 41.0 38 37.715 40.0 37.0 41.0 32.0 41.0 39 37.595 40.0 37.0 41.0 32.0 41.0 40 37.428 40.0 37.0 41.0 31.0 41.0 41 37.5005 40.0 37.0 41.0 31.0 41.0 42 37.476 40.0 37.0 41.0 32.0 41.0 43 37.416 40.0 37.0 41.0 31.0 41.0 44 37.262 40.0 36.0 41.0 31.0 41.0 45 37.37675 40.0 37.0 41.0 31.0 41.0 46 37.059 40.0 36.0 41.0 30.0 41.0 47 37.09175 39.0 36.0 41.0 31.0 41.0 48 37.03 39.0 36.0 41.0 30.0 41.0 49 37.079 39.0 36.0 41.0 31.0 41.0 50 36.94175 39.0 36.0 41.0 31.0 41.0 51 36.7495 39.0 35.0 41.0 30.0 41.0 52 35.3485 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2308 1 0.0 2308 2 0.0 2308 3 0.0 2308 4 0.0 2308 5 0.0 2308 6 0.0 2308 7 0.0 2308 8 0.0 2308 9 0.0 2308 10 0.0 2308 11 0.0 2308 12 0.0 2308 13 0.0 2308 14 0.0 2308 15 0.0 2308 16 0.0 2308 17 0.0 2308 18 0.0 2308 19 0.0 2308 20 0.0 2308 21 0.0 2308 22 0.0 2308 23 0.0 2308 24 0.0 2308 25 0.0 2308 26 0.0 2308 27 0.0 2308 28 0.0 2308 29 0.0 2308 30 0.0 2308 31 0.0 2308 32 0.0 2308 33 0.0 2308 34 0.0 2308 35 0.0 2308 36 0.0 2308 37 0.0 2308 38 0.0 2308 39 0.0 2308 40 0.0 2308 41 0.0 2308 42 0.0 2308 43 0.0 2308 44 0.0 2308 45 0.0 2308 46 0.0 2308 47 0.0 2308 48 0.0 2308 49 0.0 2308 50 0.0 2308 51 0.0 2308 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 5.0 22 1.0 23 4.0 24 9.0 25 15.0 26 22.0 27 31.0 28 36.0 29 49.0 30 62.0 31 91.0 32 124.0 33 151.0 34 212.0 35 290.0 36 349.0 37 595.0 38 996.0 39 953.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.175 10.925 5.375 45.525 2 23.45 14.075 35.075 27.400000000000002 3 21.15 18.675 23.0 37.175000000000004 4 25.45 25.874999999999996 20.225 28.449999999999996 5 25.124999999999996 31.225 23.599999999999998 20.05 6 19.5 33.35 24.8 22.35 7 15.675 24.075 40.400000000000006 19.85 8 18.3 22.625 30.575000000000003 28.499999999999996 9 17.224999999999998 21.525 34.525 26.724999999999998 10 18.325 37.6 23.875 20.200000000000003 11 22.25 29.299999999999997 21.775 26.674999999999997 12 25.900000000000002 31.324999999999996 19.05 23.724999999999998 13 20.849999999999998 27.275 27.075 24.8 14 20.849999999999998 27.950000000000003 27.175 24.025 15 20.974999999999998 25.650000000000002 28.125 25.25 16 21.65 27.425 25.974999999999998 24.95 17 21.45 26.450000000000003 27.075 25.025 18 20.974999999999998 26.400000000000002 26.825 25.8 19 21.775 26.724999999999998 25.775 25.724999999999998 20 21.525 28.249999999999996 25.8 24.425 21 19.900000000000002 27.750000000000004 26.424999999999997 25.924999999999997 22 20.674999999999997 28.625 23.825 26.875 23 20.974999999999998 28.475 25.55 25.0 24 21.025 28.225 26.05 24.7 25 21.675 27.05 24.55 26.724999999999998 26 21.224999999999998 26.424999999999997 27.325 25.025 27 21.0 27.275 26.400000000000002 25.324999999999996 28 21.725 26.525 26.55 25.2 29 20.25 28.499999999999996 26.224999999999998 25.025 30 20.9 25.825 25.7 27.575 31 21.0 28.075 26.424999999999997 24.5 32 21.2 28.525 26.525 23.75 33 21.525 26.375 26.55 25.55 34 18.975 27.175 27.875 25.974999999999998 35 20.674999999999997 26.825 25.775 26.724999999999998 36 19.875 27.525 24.525 28.075 37 20.775 26.724999999999998 25.575 26.924999999999997 38 22.7 25.324999999999996 25.2 26.775 39 20.95 26.275 25.7 27.075 40 19.75 27.275 26.5 26.474999999999998 41 21.7 27.425 24.875 26.0 42 20.575 24.975 27.025 27.425 43 22.625 26.55 24.4 26.424999999999997 44 22.775000000000002 27.474999999999998 25.25 24.5 45 22.725 24.9 26.825 25.55 46 22.625 26.474999999999998 26.325 24.575 47 22.875 27.075 24.525 25.525 48 23.45 25.95 23.775 26.825 49 20.205051262815704 26.85671417854464 25.681420355088775 27.25681420355089 50 21.825 27.275 24.7 26.200000000000003 51 22.13053263315829 26.431607901975497 24.956239059764943 26.481620405101275 52 22.425 25.424999999999997 25.474999999999998 26.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 1.0 15 2.0 16 3.0 17 4.0 18 3.0 19 2.0 20 3.0 21 4.0 22 5.0 23 6.0 24 9.5 25 13.0 26 16.5 27 20.0 28 28.0 29 36.0 30 45.5 31 55.0 32 68.5 33 82.0 34 90.0 35 98.0 36 124.5 37 151.0 38 185.5 39 228.0 40 236.0 41 249.5 42 263.0 43 301.5 44 340.0 45 335.0 46 330.0 47 335.5 48 341.0 49 327.5 50 314.0 51 334.0 52 354.0 53 334.0 54 314.0 55 272.5 56 231.0 57 205.5 58 180.0 59 147.5 60 115.0 61 118.5 62 122.0 63 92.5 64 57.0 65 51.0 66 33.0 67 15.0 68 13.5 69 12.0 70 12.0 71 12.0 72 9.0 73 6.0 74 4.0 75 2.0 76 2.0 77 2.0 78 2.5 79 3.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.025 50 0.0 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.38959288217849 88.44999999999999 2 3.18145052574818 5.8999999999999995 3 0.6740361283364789 1.875 4 0.37746023186842814 1.4000000000000001 5 0.13480722566729578 0.625 6 0.05392289026691831 0.3 7 0.026961445133459154 0.17500000000000002 8 0.13480722566729578 1.0 9 0.0 0.0 >10 0.026961445133459154 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 11 0.27499999999999997 No Hit GTCCCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAAC 8 0.2 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 8 0.2 No Hit CTACGATATTATAAGTTTCTTCCTCTTGACCAAATCTGTAACCTTCATTAGC 8 0.2 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 8 0.2 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 8 0.2 No Hit ATCAAACTAGAGGTTACCAAAGAACCATGCATAGCACTGAATAGGGAGCCGC 7 0.17500000000000002 No Hit CTCCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACT 6 0.15 No Hit GTGCATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGTA 6 0.15 No Hit GCTCAGCCTGGAATACAATCATAAAGTTAAAAGTACCAGAGATTCCTAGAGG 5 0.125 No Hit CCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGC 5 0.125 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 5 0.125 No Hit CCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTGGCCCGCAGCAGT 5 0.125 No Hit CTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTGGCCCGCAGCAGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161005 spots for SRR5423435.sra Written 161005 spots for SRR5423435.sra Read 161008 spots for SRR5423435.sra Written 161008 spots for SRR5423435.sra SRR ids: ['SRR5423435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wdfzrfx0 SRR5423435.sra spots: 3220103 blocks: [[1, 161005], [161006, 322010], [322011, 483015], [483016, 644020], [644021, 805025], [805026, 966030], [966031, 1127035], [1127036, 1288040], [1288041, 1449045], [1449046, 1610050], [1610051, 1771055], [1771056, 1932060], [1932061, 2093065], [2093066, 2254070], [2254071, 2415075], [2415076, 2576080], [2576081, 2737085], [2737086, 2898090], [2898091, 3059095], [3059096, 3220103]] SRR5423435 file size 566457 SRR5423435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423435 SRR5423435_1.fastq Input file: SRR5423435_1.fastq trimmed: SRR5423435-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 11:57:17 2025 >> started Wed Feb 12 11:57:20 2025 >> done (2.484s) 3220103 reads processed; of these: 118 ( 0.00%) short reads filtered out after trimming by size control 68 ( 0.00%) empty reads filtered out after trimming by size control 3219917 (99.99%) reads available; of these: 67606 ( 2.10%) trimmed reads available after processing 3152311 (97.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 5 0.00% 20 3 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 3 0.00% 26 2 0.00% 27 1 0.00% 28 2 0.00% 29 4 0.00% 30 1 0.00% 31 2 0.00% 32 4 0.00% 33 7 0.00% 34 8 0.00% 35 5 0.00% 36 10 0.00% 37 14 0.00% 38 14 0.00% 39 24 0.00% 40 22 0.00% 41 40 0.00% 42 49 0.00% 43 73 0.00% 44 113 0.00% 45 176 0.01% 46 291 0.01% 47 446 0.01% 48 986 0.03% 49 2248 0.07% 50 7705 0.24% 51 55336 1.72% 52 3152311 97.90% 3219917 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.46 prefix-fanout=2.0 sequence=TGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=26.30 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=1.2 sequence=CATTTTATTTCTATCTTTCCATACATAACCAAAAAATGGAAAAGATTCTTCAAGAGTCTCGGGTCCTAGAAGTGCATGATAAATACCGCCAAAGCCCAATACTGCAGAGGAAATTAAGTGAAGTACGCCAGATACAAAGTATGGAAAGGTGTCTATGACTTCCCCGCCAGGACCCACCCCCCAACCTAGAGTAGCTAGGTGGGGAAGTAAAATTAATCCTTGTTCATACATTGGCTTCTCCGGTACGAAATGGGCCACTTCAAATAGGTTCATTGCTCCGGCCCAGAATACGATTAATCCAGCATGGGCTACATGAGCTCCCAGCAG Started job on | Feb 12 11:57:34 Started mapping on | Feb 12 11:57:34 Finished on | Feb 12 11:57:39 Mapping speed, Million of reads per hour | 2318.34 Number of input reads | 3219917 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2516631 Uniquely mapped reads % | 78.16% Average mapped length | 51.79 Number of splices: Total | 229074 Number of splices: Annotated (sjdb) | 225397 Number of splices: GT/AG | 223876 Number of splices: GC/AG | 4177 Number of splices: AT/AC | 632 Number of splices: Non-canonical | 389 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 578607 % of reads mapped to multiple loci | 17.97% Number of reads mapped to too many loci | 68429 % of reads mapped to too many loci | 2.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.73% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 124679 124679 124679 N_multimapping 578607 578607 578607 N_noFeature 319899 2480665 346978 N_ambiguous 17495 140 8477 UnstrandedReadsAssigned:2179237 PositiveStrandReadsAssigned:35826 NegativeStrandReadsAssigned:2161176 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423435 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423435-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,219,917 reads, 2,614,233 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR5423435.ke.tsv 34699 SRR5423435.se.tsv 87100 total ==> SRR5423435.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 120 21.8955 Potri.005G024800.1.v4.1 1035 936 8 2.99269 Potri.004G059700.1.v4.1 961 862 4 1.6248 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 55 6.77144 Potri.016G087400.1.v4.1 270 171 20 40.9526 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.209167 Potri.012G127500.1.v4.1 977 878 3 1.19639 ==> SRR5423435.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 15 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423435 completed mapping pipeline successfully