Starting /dee2/code/volunteer_pipeline.sh SRR5423441 current disk space = 3051203067904 free memory = 1573786836 SRR5423441 SRAfilesize 0aee8aa7a120276ba6fc3ba26d688b36 SRR5423441.sra SRR5423441.sra file validated SRR5423441 is single end SRR5423441 is conventional basespace SRR5423441 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423441_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.23075 30.0 25.0 31.0 25.0 34.0 2 23.261 28.0 16.0 31.0 10.0 34.0 3 25.98525 30.0 16.0 31.0 16.0 34.0 4 30.1085 32.0 28.0 35.0 19.0 37.0 5 33.61175 35.0 33.0 35.0 28.0 37.0 6 34.4395 35.0 35.0 37.0 31.0 37.0 7 34.894 35.0 35.0 37.0 32.0 37.0 8 35.1375 36.0 35.0 37.0 32.0 37.0 9 36.96575 39.0 37.0 39.0 33.0 39.0 10 36.85825 39.0 37.0 39.0 33.0 39.0 11 36.985 39.0 37.0 39.0 33.0 39.0 12 37.0775 39.0 37.0 39.0 33.0 39.0 13 37.05425 39.0 37.0 39.0 33.0 39.0 14 38.06925 40.0 37.0 41.0 33.0 41.0 15 38.03875 40.0 37.0 41.0 33.0 41.0 16 38.01875 40.0 37.0 41.0 33.0 41.0 17 38.13725 40.0 37.0 41.0 33.0 41.0 18 38.0625 40.0 37.0 41.0 33.0 41.0 19 38.0315 40.0 37.0 41.0 33.0 41.0 20 38.194 40.0 37.0 41.0 34.0 41.0 21 37.9465 40.0 37.0 41.0 33.0 41.0 22 38.04375 40.0 37.0 41.0 33.0 41.0 23 37.833 40.0 37.0 41.0 32.0 41.0 24 37.911 40.0 37.0 41.0 33.0 41.0 25 37.93525 40.0 37.0 41.0 33.0 41.0 26 37.88375 40.0 37.0 41.0 33.0 41.0 27 37.85275 40.0 37.0 41.0 32.0 41.0 28 37.48925 39.0 37.0 41.0 32.0 41.0 29 37.81 40.0 37.0 41.0 33.0 41.0 30 37.64975 40.0 37.0 41.0 32.0 41.0 31 37.82475 40.0 37.0 41.0 33.0 41.0 32 37.661 40.0 37.0 41.0 32.0 41.0 33 37.432 40.0 36.0 41.0 31.0 41.0 34 37.5485 40.0 37.0 41.0 32.0 41.0 35 37.42625 40.0 37.0 41.0 31.0 41.0 36 36.81875 39.0 36.0 40.0 30.0 41.0 37 37.02625 39.0 36.0 40.0 30.0 41.0 38 37.083 39.0 36.0 40.0 30.0 41.0 39 36.8985 39.0 35.0 40.0 30.0 41.0 40 37.07675 39.0 36.0 40.0 31.0 41.0 41 36.9515 39.0 35.0 40.0 31.0 41.0 42 36.988 39.0 36.0 40.0 31.0 41.0 43 37.01425 39.0 36.0 40.0 31.0 41.0 44 37.0585 39.0 36.0 40.0 31.0 41.0 45 36.78575 39.0 35.0 40.0 30.0 41.0 46 36.75 39.0 35.0 40.0 30.0 41.0 47 36.799 39.0 35.0 40.0 30.0 41.0 48 36.61175 39.0 35.0 40.0 30.0 41.0 49 36.504 39.0 35.0 40.0 30.0 41.0 50 36.3645 39.0 35.0 40.0 29.0 41.0 51 36.4005 39.0 35.0 40.0 30.0 41.0 52 35.50375 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2113 1 0.0 2113 2 0.0 2113 3 0.0 2113 4 0.0 2113 5 0.0 2113 6 0.0 2113 7 0.0 2113 8 0.0 2113 9 0.0 2113 10 0.0 2113 11 0.0 2113 12 0.0 2113 13 0.0 2113 14 0.0 2113 15 0.0 2113 16 0.0 2113 17 0.0 2113 18 0.0 2113 19 0.0 2113 20 0.0 2113 21 0.0 2113 22 0.0 2113 23 0.0 2113 24 0.0 2113 25 0.0 2113 26 0.0 2113 27 0.0 2113 28 0.0 2113 29 0.0 2113 30 0.0 2113 31 0.0 2113 32 0.0 2113 33 0.0 2113 34 0.0 2113 35 0.0 2113 36 0.0 2113 37 0.0 2113 38 0.0 2113 39 0.0 2113 40 0.0 2113 41 0.0 2113 42 0.0 2113 43 0.0 2113 44 0.0 2113 45 0.0 2113 46 0.0 2113 47 0.0 2113 48 0.0 2113 49 0.0 2113 50 0.0 2113 51 0.0 2113 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 4.0 23 8.0 24 10.0 25 18.0 26 22.0 27 28.0 28 58.0 29 57.0 30 91.0 31 136.0 32 151.0 33 177.0 34 270.0 35 329.0 36 447.0 37 651.0 38 855.0 39 682.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.40310465698548 9.664496745117676 6.359539308963445 48.5728592889334 2 39.1 15.024999999999999 27.675 18.2 3 23.575 18.55 22.650000000000002 35.225 4 25.775 25.324999999999996 22.975 25.924999999999997 5 24.8 29.849999999999998 24.175 21.175 6 19.425 33.300000000000004 24.349999999999998 22.925 7 16.6 23.1 41.875 18.425 8 18.6 21.675 30.65 29.075 9 18.625 20.3 34.725 26.35 10 18.375 37.45 24.775 19.400000000000002 11 22.650000000000002 28.499999999999996 20.674999999999997 28.175 12 20.4 24.625 27.750000000000004 27.224999999999998 13 18.15 27.075 29.925 24.85 14 20.05 27.700000000000003 28.449999999999996 23.799999999999997 15 20.8 27.224999999999998 27.450000000000003 24.525 16 20.25 28.050000000000004 26.875 24.825 17 22.05 27.1 26.1 24.75 18 20.95 27.05 25.7 26.3 19 20.65 27.450000000000003 25.75 26.150000000000002 20 21.425 25.95 26.575 26.05 21 20.424999999999997 26.25 27.150000000000002 26.174999999999997 22 21.15 27.425 25.1 26.325 23 21.975 26.974999999999998 24.9 26.150000000000002 24 22.15 28.1 25.025 24.725 25 21.224999999999998 27.725 26.575 24.474999999999998 26 22.650000000000002 27.800000000000004 25.85 23.7 27 20.05 25.874999999999996 27.6 26.474999999999998 28 21.375 27.750000000000004 26.325 24.55 29 21.5 28.325 26.900000000000002 23.275000000000002 30 20.575 26.650000000000002 26.8 25.974999999999998 31 21.725 26.525 26.224999999999998 25.525 32 19.6 28.050000000000004 25.75 26.6 33 20.8 28.075 26.525 24.6 34 20.825 26.174999999999997 28.675 24.325 35 20.625 27.0 26.5 25.874999999999996 36 21.775 26.424999999999997 24.7 27.1 37 20.65 25.924999999999997 26.1 27.325 38 21.65 26.125 25.55 26.674999999999997 39 20.549999999999997 26.924999999999997 26.55 25.974999999999998 40 20.9 27.500000000000004 26.325 25.275 41 21.0 26.375 25.8 26.825 42 21.575 25.674999999999997 27.125 25.624999999999996 43 22.475 26.075 26.55 24.9 44 22.7 26.55 26.200000000000003 24.55 45 22.75 25.825 25.224999999999998 26.200000000000003 46 21.9 27.725 26.275 24.099999999999998 47 22.225 27.375 24.0 26.400000000000002 48 22.375 25.7 25.825 26.1 49 22.25 26.55 24.775 26.424999999999997 50 23.599999999999998 25.0 26.1 25.3 51 21.25 25.6 26.474999999999998 26.674999999999997 52 22.5 26.325 25.25 25.924999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 4.0 20 5.5 21 7.0 22 8.0 23 9.0 24 11.0 25 13.0 26 15.5 27 18.0 28 29.0 29 40.0 30 43.0 31 46.0 32 73.0 33 100.0 34 105.0 35 110.0 36 144.5 37 179.0 38 187.0 39 226.5 40 258.0 41 269.0 42 280.0 43 290.5 44 301.0 45 302.5 46 304.0 47 323.5 48 343.0 49 337.0 50 331.0 51 328.5 52 326.0 53 318.5 54 311.0 55 272.5 56 234.0 57 204.0 58 174.0 59 157.5 60 141.0 61 123.0 62 105.0 63 86.5 64 50.0 65 32.0 66 27.5 67 23.0 68 19.0 69 15.0 70 13.0 71 11.0 72 11.5 73 12.0 74 8.0 75 4.0 76 3.0 77 2.0 78 1.5 79 1.0 80 1.0 81 1.0 82 1.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.475 #Duplication Level Percentage of deduplicated Percentage of total 1 95.45823195458232 88.275 2 2.8926736955934036 5.35 3 0.8921330089213302 2.475 4 0.3514463368477967 1.3 5 0.13517166801838335 0.625 6 0.10813733441470669 0.6 7 0.08110300081103002 0.525 8 0.0 0.0 9 0.027034333603676672 0.22499999999999998 >10 0.054068667207353344 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 13 0.325 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 12 0.3 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 9 0.22499999999999998 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 7 0.17500000000000002 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 7 0.17500000000000002 No Hit CTCGGTTGCTGGAACCTCCATGACTCCAGTGTAGACATGGCTCTTCTCAGTC 7 0.17500000000000002 No Hit GGGCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAGAT 6 0.15 No Hit CTCTTGACCAAATCTGTAACCTTCATTAGCAGATTCATTTTCTGTGGTTTCC 6 0.15 No Hit CTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGCA 6 0.15 No Hit AGAAGATTCAGCAGCTACTGCGGCCCCTGCTTCCTCGGGCGGAACTCCAGGT 6 0.15 No Hit CTCGGGTCCTAGAAGTGCATGATAAATACCGCCAAAGCCCAATACTGCAGAG 5 0.125 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit GTCCTAGAAGTGCATGATAAATACCGCCAAAGCCCAATACTGCAGAGGAAAT 5 0.125 No Hit GCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAGATCA 5 0.125 No Hit AGCACGGTTAATAATATCAGCCCAGGTATTAATTACACGACCTTGACTATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra Read 200000 spots for SRR5423441.sra Written 200000 spots for SRR5423441.sra SRR ids: ['SRR5423441.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qwztnisg SRR5423441.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423441 file size 704002 SRR5423441 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423441 SRR5423441_1.fastq Input file: SRR5423441_1.fastq trimmed: SRR5423441-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 13:14:11 2025 >> started Wed Feb 12 13:14:13 2025 >> done (2.007s) 4000000 reads processed; of these: 188 ( 0.00%) short reads filtered out after trimming by size control 208 ( 0.01%) empty reads filtered out after trimming by size control 3999604 (99.99%) reads available; of these: 95259 ( 2.38%) trimmed reads available after processing 3904345 (97.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 5 0.00% 20 9 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 2 0.00% 26 3 0.00% 27 5 0.00% 28 2 0.00% 29 5 0.00% 30 8 0.00% 31 11 0.00% 32 12 0.00% 33 16 0.00% 34 15 0.00% 35 24 0.00% 36 29 0.00% 37 27 0.00% 38 32 0.00% 39 62 0.00% 40 76 0.00% 41 103 0.00% 42 162 0.00% 43 209 0.01% 44 458 0.01% 45 496 0.01% 46 693 0.02% 47 1189 0.03% 48 2037 0.05% 49 4584 0.11% 50 12789 0.32% 51 72181 1.80% 52 3904345 97.62% 3999604 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=6.56 fanout-score-rank=5 prefix-density=0.78 prefix-fanout=1.5 sequence=ACGTGCTTAATACGTGCTTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=18.70 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=1.3 sequence=CATTTTATTTCTATCTTTCCATACATAACCAAAAAATGGAAAAGATTCTTCAAGAGTCTCGGGTCCTAGAAGTGCATGATAAATACCGCCAAAGCCCAATACTGCAGAGGAAATTAAGTGAAGTACGCCAGATACAAAGTATGGAAAGGTGTCTATGACTTCCCCGCCAGGACCCACCCCCCAACCTAGAGTAGCTAGGTGGGGAAGTAAAATTAATCCTTGTTCATACATTGGCTTCTCCGGTACGAAATGGGCCACTTCAAATAGGTTCATTGCTCCGGCCCAGAATACGATTAATCCAGCATGGGCTACATGAGCTCCCAGCAG Started job on | Feb 12 13:14:26 Started mapping on | Feb 12 13:14:26 Finished on | Feb 12 13:14:32 Mapping speed, Million of reads per hour | 2399.76 Number of input reads | 3999604 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3140550 Uniquely mapped reads % | 78.52% Average mapped length | 51.72 Number of splices: Total | 298263 Number of splices: Annotated (sjdb) | 293656 Number of splices: GT/AG | 291726 Number of splices: GC/AG | 5282 Number of splices: AT/AC | 766 Number of splices: Non-canonical | 489 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 678519 % of reads mapped to multiple loci | 16.96% Number of reads mapped to too many loci | 104653 % of reads mapped to too many loci | 2.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.89% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 180535 180535 180535 N_multimapping 678519 678519 678519 N_noFeature 406644 3093871 442833 N_ambiguous 19957 154 9329 UnstrandedReadsAssigned:2713949 PositiveStrandReadsAssigned:46525 NegativeStrandReadsAssigned:2688388 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423441 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423441-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,604 reads, 3,250,868 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,366 rounds 52401 SRR5423441.ke.tsv 34699 SRR5423441.se.tsv 87100 total ==> SRR5423441.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 153 21.7188 Potri.005G024800.1.v4.1 1035 936 23.1022 6.72351 Potri.004G059700.1.v4.1 961 862 1 0.316018 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 58.3898 5.59277 Potri.016G087400.1.v4.1 270 171 12 19.1163 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 3.71574 0.604656 Potri.012G127500.1.v4.1 977 878 5 1.5513 ==> SRR5423441.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 29 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423441 completed mapping pipeline successfully