Starting /dee2/code/volunteer_pipeline.sh SRR5423445 current disk space = 3051409977344 free memory = 1582672072 SRR5423445 SRAfilesize acdf7f11f919e6da8dea06caeb94420c SRR5423445.sra SRR5423445.sra file validated SRR5423445 is single end SRR5423445 is conventional basespace SRR5423445 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423445_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.9105 16.0 16.0 28.0 16.0 30.0 2 22.9815 25.0 16.0 30.0 16.0 30.0 3 24.4505 28.0 16.0 30.0 16.0 31.0 4 29.301 33.0 25.0 35.0 19.0 35.0 5 23.563 19.0 19.0 32.0 10.0 35.0 6 22.49225 19.0 17.0 31.0 10.0 33.0 7 23.6185 26.0 17.0 32.0 10.0 35.0 8 24.93525 28.0 17.0 32.0 15.0 35.0 9 24.55975 27.0 17.0 32.0 10.0 35.0 10 26.5075 28.0 17.0 34.0 15.0 35.0 11 27.25025 30.0 18.0 34.0 15.0 35.0 12 26.123 27.0 17.0 34.0 11.0 35.0 13 26.578 30.0 17.0 34.0 11.0 35.0 14 27.5345 31.0 22.0 34.0 11.0 36.0 15 28.35875 32.0 25.0 34.0 16.0 37.0 16 27.79825 31.0 24.0 34.0 11.0 37.0 17 27.9795 31.0 24.0 34.0 11.0 37.0 18 24.72125 27.0 17.0 32.0 10.0 36.0 19 26.61775 29.0 18.0 34.0 10.0 37.0 20 26.20225 27.0 18.0 34.0 10.0 37.0 21 26.867 30.0 19.0 34.0 10.0 37.0 22 26.456 30.0 18.0 34.0 10.0 37.0 23 25.59325 27.0 18.0 34.0 10.0 37.0 24 25.59925 27.0 18.0 34.0 10.0 36.0 25 24.45925 27.0 17.0 32.0 10.0 36.0 26 21.4425 23.0 10.0 31.0 8.0 34.0 27 21.21225 23.0 10.0 30.0 8.0 34.0 28 21.97525 24.0 10.0 31.0 9.0 34.0 29 22.775 25.0 15.0 31.0 9.0 35.0 30 23.23575 25.0 15.0 32.0 9.0 35.0 31 23.498 25.0 15.0 32.0 9.0 35.0 32 19.01025 16.0 9.0 27.0 8.0 34.0 33 20.336 20.0 9.0 30.0 8.0 34.0 34 21.9075 24.0 14.0 30.0 8.0 35.0 35 21.84675 24.0 12.0 30.0 8.0 35.0 36 20.1765 19.0 9.0 30.0 8.0 34.0 37 19.585 17.0 9.0 30.0 8.0 34.0 38 19.19925 16.0 9.0 28.0 8.0 33.0 39 20.523 23.0 9.0 30.0 8.0 33.0 40 19.9835 20.0 9.0 30.0 8.0 34.0 41 21.294 23.0 13.0 30.0 8.0 34.0 42 20.4855 22.0 9.0 30.0 8.0 33.0 43 21.3015 23.0 12.0 30.0 8.0 34.0 44 21.51575 23.0 12.0 30.0 8.0 34.0 45 20.5975 22.0 9.0 30.0 8.0 34.0 46 19.857 20.0 9.0 30.0 7.0 33.0 47 20.05425 21.0 9.0 30.0 7.0 33.0 48 20.333 22.0 9.0 30.0 8.0 33.0 49 19.45675 20.0 9.0 28.0 7.0 33.0 50 18.977 18.0 9.0 28.0 7.0 33.0 51 16.97475 14.0 8.0 25.0 7.0 31.0 52 16.8115 14.0 8.0 24.0 7.0 31.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 1.0 11 3.0 12 0.0 13 8.0 14 9.0 15 40.0 16 60.0 17 124.0 18 188.0 19 277.0 20 360.0 21 410.0 22 476.0 23 489.0 24 457.0 25 385.0 26 279.0 27 200.0 28 146.0 29 66.0 30 14.0 31 7.0 32 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.93373343335834 13.15328832208052 5.051262815703926 46.86171542885722 2 21.349999999999998 14.05 37.2 27.400000000000002 3 19.1 18.625 25.174999999999997 37.1 4 26.275 25.05 20.125 28.549999999999997 5 41.125 22.95 10.549999999999999 25.374999999999996 6 21.075 28.549999999999997 22.625 27.750000000000004 7 15.35 22.325 39.85 22.475 8 19.900000000000002 17.724999999999998 31.424999999999997 30.95 9 17.525 18.925 31.85 31.7 10 17.05 31.275 28.375 23.3 11 23.150000000000002 22.625 23.45 30.775000000000002 12 24.099999999999998 21.175 26.950000000000003 27.775 13 20.925 26.35 24.25 28.475 14 20.200000000000003 24.025 28.425 27.35 15 22.650000000000002 23.425 26.150000000000002 27.775 16 21.475 23.925 28.225 26.375 17 22.175 23.875 27.224999999999998 26.724999999999998 18 21.625 24.85 24.175 29.349999999999998 19 22.275 23.474999999999998 25.174999999999997 29.075 20 18.975 27.500000000000004 25.775 27.750000000000004 21 23.474999999999998 25.174999999999997 23.25 28.1 22 19.900000000000002 26.450000000000003 22.625 31.025000000000002 23 19.725 26.8 24.925 28.549999999999997 24 21.224999999999998 26.1 27.775 24.9 25 20.1 26.674999999999997 24.625 28.599999999999998 26 21.45 28.299999999999997 22.55 27.700000000000003 27 22.3 27.200000000000003 22.45 28.050000000000004 28 21.875 28.449999999999996 23.799999999999997 25.874999999999996 29 21.725 25.224999999999998 25.775 27.275 30 21.075 25.724999999999998 27.625 25.575 31 19.55 25.2 25.900000000000002 29.349999999999998 32 20.875 29.075 24.55 25.5 33 23.200000000000003 26.55 22.775000000000002 27.474999999999998 34 21.875 24.075 24.55 29.5 35 21.55 27.375 22.525000000000002 28.549999999999997 36 23.799999999999997 28.15 18.95 29.099999999999998 37 23.625 25.15 25.025 26.200000000000003 38 23.175 25.074999999999996 24.4 27.35 39 23.474999999999998 24.15 23.3 29.075 40 23.599999999999998 25.074999999999996 23.0 28.325 41 21.099999999999998 25.2 24.925 28.775000000000002 42 21.85 27.55 22.25 28.349999999999998 43 26.325 23.549999999999997 21.65 28.475 44 24.65 22.8 25.025 27.525 45 24.099999999999998 21.825 26.625 27.450000000000003 46 21.8 24.775 24.65 28.775000000000002 47 25.75 25.424999999999997 22.75 26.075 48 23.200000000000003 24.85 24.925 27.025 49 22.125 26.075 23.400000000000002 28.4 50 23.25 26.125 22.5 28.125 51 21.0 27.250000000000004 23.599999999999998 28.15 52 20.775 26.85 24.75 27.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 2.0 17 3.0 18 3.0 19 3.0 20 5.0 21 7.0 22 6.0 23 5.0 24 11.5 25 18.0 26 26.5 27 35.0 28 37.5 29 40.0 30 44.5 31 49.0 32 68.5 33 88.0 34 89.5 35 91.0 36 105.5 37 120.0 38 134.5 39 178.0 40 207.0 41 228.5 42 250.0 43 259.0 44 268.0 45 278.5 46 289.0 47 278.5 48 268.0 49 276.0 50 284.0 51 281.0 52 278.0 53 253.5 54 229.0 55 210.5 56 192.0 57 185.0 58 178.0 59 174.5 60 171.0 61 150.0 62 129.0 63 125.5 64 111.5 65 101.0 66 95.5 67 90.0 68 83.0 69 76.0 70 67.0 71 58.0 72 57.0 73 56.0 74 50.0 75 44.0 76 38.5 77 33.0 78 26.5 79 20.0 80 19.0 81 18.0 82 15.5 83 13.0 84 11.5 85 10.0 86 8.0 87 6.0 88 3.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67852604828462 97.075 2 1.0165184243964422 2.0 3 0.2795425667090216 0.8250000000000001 4 0.025412960609911054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7955 spots for SRR5423445.sra Written 7955 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra Read 7940 spots for SRR5423445.sra Written 7940 spots for SRR5423445.sra SRR ids: ['SRR5423445.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gnmmbidd SRR5423445.sra spots: 158815 blocks: [[1, 7940], [7941, 15880], [15881, 23820], [23821, 31760], [31761, 39700], [39701, 47640], [47641, 55580], [55581, 63520], [63521, 71460], [71461, 79400], [79401, 87340], [87341, 95280], [95281, 103220], [103221, 111160], [111161, 119100], [119101, 127040], [127041, 134980], [134981, 142920], [142921, 150860], [150861, 158815]] SRR5423445 file size 27728 SRR5423445 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423445 SRR5423445_1.fastq Input file: SRR5423445_1.fastq trimmed: SRR5423445-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 13:50:56 2025 >> started Wed Feb 12 13:50:56 2025 >> done (0.140s) 158815 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 3 ( 0.00%) empty reads filtered out after trimming by size control 158811 (100.00%) reads available; of these: 34548 (21.75%) trimmed reads available after processing 124263 (78.25%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 33 2 0.00% 34 0 0.00% 35 2 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 6 0.00% 40 2 0.00% 41 1 0.00% 42 6 0.00% 43 20 0.01% 44 32 0.02% 45 64 0.04% 46 118 0.07% 47 296 0.19% 48 749 0.47% 49 1980 1.25% 50 6372 4.01% 51 24898 15.68% 52 124263 78.25% 158811 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.00 fanout-score-rank=13 prefix-density=0.07 prefix-fanout=1.0 sequence=CTGCATGCATTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=22.91 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=1.9 sequence=CCGCCGCTCGGGGGGAA Started job on | Feb 12 13:51:11 Started mapping on | Feb 12 13:51:12 Finished on | Feb 12 13:51:21 Mapping speed, Million of reads per hour | 63.52 Number of input reads | 158811 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 102751 Uniquely mapped reads % | 64.70% Average mapped length | 51.21 Number of splices: Total | 8336 Number of splices: Annotated (sjdb) | 8117 Number of splices: GT/AG | 8166 Number of splices: GC/AG | 124 Number of splices: AT/AC | 23 Number of splices: Non-canonical | 23 Mismatch rate per base, % | 3.21% Deletion rate per base | 0.01% Deletion average length | 2.19 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 23164 % of reads mapped to multiple loci | 14.59% Number of reads mapped to too many loci | 3490 % of reads mapped to too many loci | 2.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.50% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 32896 32896 32896 N_multimapping 23164 23164 23164 N_noFeature 12943 101256 14089 N_ambiguous 666 9 309 UnstrandedReadsAssigned:89142 PositiveStrandReadsAssigned:1486 NegativeStrandReadsAssigned:88353 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=51 echo kmer=47 SRR5423445 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423445-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 158,811 reads, 70,931 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 702 rounds 52401 SRR5423445.ke.tsv 34699 SRR5423445.se.tsv 87100 total ==> SRR5423445.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1 6.38081 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 0 0 Potri.016G087400.1.v4.1 270 171 0 0 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 0 0 ==> SRR5423445.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 0 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423445 completed mapping pipeline successfully