Starting /dee2/code/volunteer_pipeline.sh SRR5423450 current disk space = 3051754393600 free memory = 1582277676 SRR5423450 SRAfilesize a937dc7e4fa26a9cfa864c571a92a57d SRR5423450.sra SRR5423450.sra file validated SRR5423450 is single end SRR5423450 is conventional basespace SRR5423450 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423450_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.85 31.0 30.0 34.0 28.0 34.0 2 31.3455 31.0 31.0 34.0 28.0 34.0 3 31.556 31.0 31.0 34.0 30.0 34.0 4 31.28525 35.0 30.0 37.0 16.0 37.0 5 33.82175 35.0 33.0 37.0 28.0 37.0 6 34.57525 35.0 35.0 37.0 31.0 37.0 7 35.05825 35.0 35.0 37.0 32.0 37.0 8 35.06825 37.0 35.0 37.0 32.0 37.0 9 36.8675 39.0 37.0 39.0 33.0 39.0 10 36.72775 39.0 35.0 39.0 32.0 39.0 11 36.61125 39.0 35.0 39.0 32.0 39.0 12 36.85225 39.0 37.0 39.0 33.0 39.0 13 36.63725 39.0 35.0 39.0 32.0 39.0 14 37.91275 40.0 37.0 41.0 33.0 41.0 15 37.84775 40.0 37.0 41.0 32.0 41.0 16 37.5655 40.0 37.0 41.0 32.0 41.0 17 37.554 40.0 36.0 41.0 32.0 41.0 18 37.85175 40.0 37.0 41.0 33.0 41.0 19 37.8895 40.0 37.0 41.0 32.0 41.0 20 37.98925 40.0 37.0 41.0 33.0 41.0 21 37.88575 40.0 37.0 41.0 33.0 41.0 22 37.776 40.0 37.0 41.0 32.0 41.0 23 37.69675 40.0 37.0 41.0 32.0 41.0 24 37.58375 39.0 37.0 41.0 32.0 41.0 25 37.597 39.0 37.0 41.0 32.0 41.0 26 37.438 39.0 37.0 41.0 31.0 41.0 27 37.484 39.0 37.0 41.0 32.0 41.0 28 37.19425 39.0 36.0 41.0 31.0 41.0 29 37.399 39.0 36.0 41.0 32.0 41.0 30 37.41375 39.0 36.0 41.0 31.0 41.0 31 37.389 39.0 36.0 41.0 31.0 41.0 32 37.2955 39.0 37.0 41.0 31.0 41.0 33 37.27675 39.0 36.0 41.0 31.0 41.0 34 37.25075 39.0 36.0 41.0 31.0 41.0 35 37.206 39.0 36.0 41.0 31.0 41.0 36 37.19275 39.0 36.0 41.0 31.0 41.0 37 37.0445 39.0 36.0 41.0 30.0 41.0 38 36.90475 39.0 36.0 40.0 30.0 41.0 39 36.99375 39.0 36.0 40.0 30.0 41.0 40 36.9215 39.0 36.0 40.0 30.0 41.0 41 36.795 39.0 36.0 40.0 30.0 41.0 42 36.7255 39.0 35.0 40.0 30.0 41.0 43 36.7245 39.0 36.0 40.0 30.0 41.0 44 36.527 39.0 35.0 40.0 30.0 41.0 45 36.44 39.0 35.0 40.0 30.0 41.0 46 36.30375 39.0 35.0 40.0 29.0 41.0 47 36.2105 38.0 35.0 40.0 29.0 41.0 48 36.35825 39.0 35.0 40.0 29.0 41.0 49 36.2825 39.0 35.0 40.0 29.0 41.0 50 36.3525 39.0 35.0 40.0 29.0 41.0 51 36.06225 38.0 35.0 40.0 28.0 41.0 52 35.05375 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2112 1 0.0 2112 2 0.0 2112 3 0.0 2112 4 0.0 2112 5 0.0 2112 6 0.0 2112 7 0.0 2112 8 0.0 2112 9 0.0 2112 10 0.0 2112 11 0.0 2112 12 0.0 2112 13 0.0 2112 14 0.0 2112 15 0.0 2112 16 0.0 2112 17 0.0 2112 18 0.0 2112 19 0.0 2112 20 0.0 2112 21 0.0 2112 22 0.0 2112 23 0.0 2112 24 0.0 2112 25 0.0 2112 26 0.0 2112 27 0.0 2112 28 0.0 2112 29 0.0 2112 30 0.0 2112 31 0.0 2112 32 0.0 2112 33 0.0 2112 34 0.0 2112 35 0.0 2112 36 0.0 2112 37 0.0 2112 38 0.0 2112 39 0.0 2112 40 0.0 2112 41 0.0 2112 42 0.0 2112 43 0.0 2112 44 0.0 2112 45 0.0 2112 46 0.0 2112 47 0.0 2112 48 0.0 2112 49 0.0 2112 50 0.0 2112 51 0.0 2112 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 4.0 22 0.0 23 17.0 24 16.0 25 26.0 26 19.0 27 39.0 28 43.0 29 79.0 30 80.0 31 103.0 32 147.0 33 209.0 34 227.0 35 304.0 36 448.0 37 512.0 38 775.0 39 951.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.64282141070535 11.180590295147574 6.128064032016009 47.04852426213107 2 22.625 14.7 35.175 27.500000000000004 3 21.3 19.7 22.650000000000002 36.35 4 26.275 25.15 22.05 26.525 5 24.6 31.7 22.900000000000002 20.8 6 17.9 33.025 25.1 23.974999999999998 7 14.424999999999999 22.8 42.35 20.424999999999997 8 17.525 23.150000000000002 30.95 28.375 9 17.9 21.3 33.875 26.924999999999997 10 17.4 39.6 23.425 19.575 11 22.8 28.7 21.125 27.375 12 21.224999999999998 25.624999999999996 26.674999999999997 26.474999999999998 13 19.125 27.224999999999998 28.625 25.025 14 19.650000000000002 28.125 28.225 24.0 15 21.125 27.675 26.674999999999997 24.525 16 20.5 27.05 27.125 25.324999999999996 17 21.0 27.975 26.424999999999997 24.6 18 21.3 26.575 25.5 26.625 19 19.6 29.225 26.075 25.1 20 21.4 26.575 27.200000000000003 24.825 21 21.375 27.05 26.275 25.3 22 21.525 27.625 25.8 25.05 23 21.349999999999998 28.175 25.900000000000002 24.575 24 21.375 26.950000000000003 26.825 24.85 25 21.475 28.499999999999996 25.424999999999997 24.6 26 22.6 25.95 27.375 24.075 27 21.775 26.974999999999998 26.150000000000002 25.1 28 20.65 28.975 25.874999999999996 24.5 29 20.75 28.849999999999998 27.55 22.85 30 20.0 26.525 26.275 27.200000000000003 31 20.474999999999998 28.775000000000002 26.375 24.375 32 20.549999999999997 28.675 27.224999999999998 23.549999999999997 33 22.075 25.624999999999996 27.075 25.224999999999998 34 20.25 27.800000000000004 26.05 25.900000000000002 35 21.075 26.35 25.8 26.775 36 21.2 27.1 25.15 26.55 37 21.05 26.375 26.025 26.55 38 21.15 25.900000000000002 26.724999999999998 26.224999999999998 39 20.825 27.200000000000003 25.1 26.875 40 21.875 26.8 24.75 26.575 41 21.7 27.025 25.424999999999997 25.85 42 21.025 25.974999999999998 26.424999999999997 26.575 43 22.0 26.400000000000002 26.3 25.3 44 22.8 26.400000000000002 27.125 23.674999999999997 45 22.400000000000002 25.324999999999996 25.775 26.5 46 22.975 26.325 25.7 25.0 47 22.625 27.6 24.65 25.124999999999996 48 21.4 26.900000000000002 23.625 28.075 49 21.525 26.825 24.675 26.974999999999998 50 23.58089522380595 26.18154538634659 25.006251562890725 25.23130782695674 51 23.525 26.05 24.725 25.7 52 22.8 27.425 23.5 26.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 4.0 18 2.5 19 1.0 20 5.0 21 9.0 22 11.0 23 13.0 24 9.5 25 6.0 26 13.0 27 20.0 28 30.0 29 40.0 30 49.0 31 58.0 32 72.5 33 87.0 34 111.0 35 135.0 36 150.5 37 166.0 38 189.0 39 238.0 40 264.0 41 263.0 42 262.0 43 287.0 44 312.0 45 312.0 46 312.0 47 331.5 48 351.0 49 334.5 50 318.0 51 329.0 52 340.0 53 342.5 54 345.0 55 272.0 56 199.0 57 176.0 58 153.0 59 137.0 60 121.0 61 119.5 62 118.0 63 91.0 64 49.0 65 34.0 66 26.5 67 19.0 68 16.0 69 13.0 70 9.5 71 6.0 72 7.5 73 9.0 74 5.0 75 1.0 76 1.5 77 2.0 78 2.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.8 #Duplication Level Percentage of deduplicated Percentage of total 1 94.12583518930958 84.52499999999999 2 3.7583518930957682 6.75 3 0.9465478841870825 2.55 4 0.4454342984409799 1.6 5 0.22271714922048996 1.0 6 0.19487750556792874 1.05 7 0.11135857461024498 0.7000000000000001 8 0.05567928730512249 0.4 9 0.05567928730512249 0.44999999999999996 >10 0.08351893095768374 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 18 0.44999999999999996 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 11 0.27499999999999997 No Hit CTCAGCCTGGAATACAATCATAAAGTTAAAAGTACCAGAGATTCCTAGAGGC 10 0.25 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 9 0.22499999999999998 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 9 0.22499999999999998 No Hit GCCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTAC 8 0.2 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 8 0.2 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 7 0.17500000000000002 No Hit CCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGC 7 0.17500000000000002 No Hit GTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCC 7 0.17500000000000002 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 6 0.15 No Hit CCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCCCT 6 0.15 No Hit GCCCCATGTAACAAGCTACACCAAGTAAGAAGTGTAGAACAATTAGCTCATA 6 0.15 No Hit CTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGCA 6 0.15 No Hit ATCAAACTAGAGGTTACCAAAGAACCATGCATAGCACTGAATAGGGAGCCGC 6 0.15 No Hit CTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTGGCCCGCAGCAGTA 6 0.15 No Hit GCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAGATCA 6 0.15 No Hit GGGCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAGAT 5 0.125 No Hit GTCCCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAAC 5 0.125 No Hit GTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCCCTGCTTCCTCGG 5 0.125 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 5 0.125 No Hit GTGCATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGTA 5 0.125 No Hit GCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA 5 0.125 No Hit GCCGCTTCCCATATTGGGTAAAAGTGCAACCCTATAGCCGCAGAAGTAGGAA 5 0.125 No Hit AGCACGGTTAATAATATCAGCCCAGGTATTAATTACACGACCTTGACTATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra Read 200000 spots for SRR5423450.sra Written 200000 spots for SRR5423450.sra SRR ids: ['SRR5423450.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i56h9b5p SRR5423450.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423450 file size 703992 SRR5423450 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423450 SRR5423450_1.fastq Input file: SRR5423450_1.fastq trimmed: SRR5423450-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 14:52:17 2025 >> started Wed Feb 12 14:52:19 2025 >> done (2.092s) 4000000 reads processed; of these: 158 ( 0.00%) short reads filtered out after trimming by size control 175 ( 0.00%) empty reads filtered out after trimming by size control 3999667 (99.99%) reads available; of these: 151661 ( 3.79%) trimmed reads available after processing 3848006 (96.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 8 0.00% 20 4 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 6 0.00% 27 4 0.00% 28 10 0.00% 29 6 0.00% 30 2 0.00% 31 18 0.00% 32 12 0.00% 33 12 0.00% 34 29 0.00% 35 25 0.00% 36 35 0.00% 37 50 0.00% 38 60 0.00% 39 73 0.00% 40 89 0.00% 41 136 0.00% 42 225 0.01% 43 284 0.01% 44 523 0.01% 45 674 0.02% 46 911 0.02% 47 1564 0.04% 48 2727 0.07% 49 5979 0.15% 50 17622 0.44% 51 120549 3.01% 52 3848006 96.21% 3999667 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.61 fanout-score-rank=7 prefix-density=0.74 prefix-fanout=1.5 sequence=ACGTGCTTAATACGTGCTTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=54.01 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=1.1 sequence=CCCCTCTGCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAG Started job on | Feb 12 14:52:32 Started mapping on | Feb 12 14:52:32 Finished on | Feb 12 14:52:43 Mapping speed, Million of reads per hour | 1308.98 Number of input reads | 3999667 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3131328 Uniquely mapped reads % | 78.29% Average mapped length | 51.70 Number of splices: Total | 296488 Number of splices: Annotated (sjdb) | 291787 Number of splices: GT/AG | 289925 Number of splices: GC/AG | 5252 Number of splices: AT/AC | 827 Number of splices: Non-canonical | 484 Mismatch rate per base, % | 0.61% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 679938 % of reads mapped to multiple loci | 17.00% Number of reads mapped to too many loci | 102021 % of reads mapped to too many loci | 2.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 188401 188401 188401 N_multimapping 679938 679938 679938 N_noFeature 405456 3085303 441094 N_ambiguous 19834 145 9320 UnstrandedReadsAssigned:2706038 PositiveStrandReadsAssigned:45880 NegativeStrandReadsAssigned:2680914 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423450 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423450-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,667 reads, 3,153,736 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR5423450.ke.tsv 34699 SRR5423450.se.tsv 87100 total ==> SRR5423450.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 131 19.2845 Potri.005G024800.1.v4.1 1035 936 28 8.45072 Potri.004G059700.1.v4.1 961 862 4 1.31088 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 69.8566 6.93888 Potri.016G087400.1.v4.1 270 171 12 19.8242 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 6 1.93049 ==> SRR5423450.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 29 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423450 completed mapping pipeline successfully