Starting /dee2/code/volunteer_pipeline.sh SRR5423453 current disk space = 3051822186496 free memory = 1576441580 SRR5423453 SRAfilesize 4caa2e93cd9906394dce14e8d51e84f3 SRR5423453.sra SRR5423453.sra file validated SRR5423453 is single end SRR5423453 is conventional basespace SRR5423453 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423453_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.18475 34.0 31.0 34.0 26.0 34.0 2 31.39625 34.0 31.0 34.0 26.0 34.0 3 32.3035 34.0 31.0 34.0 28.0 34.0 4 35.9295 37.0 35.0 37.0 35.0 37.0 5 35.994 37.0 35.0 37.0 35.0 37.0 6 35.989 37.0 35.0 37.0 35.0 37.0 7 36.05525 37.0 35.0 37.0 35.0 37.0 8 36.04375 37.0 35.0 37.0 35.0 37.0 9 37.75225 39.0 38.0 39.0 35.0 39.0 10 37.40225 39.0 37.0 39.0 35.0 39.0 11 37.7185 39.0 37.0 39.0 35.0 39.0 12 37.72775 39.0 38.0 39.0 35.0 39.0 13 37.6525 39.0 37.0 39.0 35.0 39.0 14 39.10225 40.0 38.0 41.0 36.0 41.0 15 38.997 40.0 38.0 41.0 36.0 41.0 16 39.01625 40.0 38.0 41.0 36.0 41.0 17 38.95825 40.0 38.0 41.0 36.0 41.0 18 38.896 40.0 38.0 41.0 36.0 41.0 19 38.9515 40.0 39.0 41.0 35.0 41.0 20 38.78025 40.0 38.0 41.0 34.0 41.0 21 38.8245 40.0 38.0 41.0 34.0 41.0 22 38.82825 40.0 38.0 41.0 35.0 41.0 23 38.8665 40.0 38.0 41.0 35.0 41.0 24 38.74725 40.0 38.0 41.0 35.0 41.0 25 38.6755 40.0 38.0 41.0 34.0 41.0 26 38.7235 40.0 38.0 41.0 35.0 41.0 27 38.61325 40.0 38.0 41.0 34.0 41.0 28 38.511 40.0 38.0 41.0 34.0 41.0 29 38.57325 40.0 38.0 41.0 35.0 41.0 30 38.53025 40.0 38.0 41.0 34.0 41.0 31 38.408 40.0 38.0 41.0 34.0 41.0 32 38.3425 40.0 38.0 41.0 34.0 41.0 33 38.35125 40.0 38.0 41.0 34.0 41.0 34 38.2815 40.0 38.0 41.0 34.0 41.0 35 38.22025 40.0 38.0 41.0 34.0 41.0 36 38.182 40.0 38.0 41.0 33.0 41.0 37 37.82825 40.0 38.0 41.0 32.0 41.0 38 37.84725 40.0 38.0 41.0 33.0 41.0 39 37.81325 40.0 38.0 41.0 33.0 41.0 40 37.876 40.0 38.0 41.0 33.0 41.0 41 37.8135 40.0 38.0 41.0 33.0 41.0 42 37.53125 40.0 37.0 41.0 31.0 41.0 43 37.34275 40.0 37.0 41.0 31.0 41.0 44 37.25425 40.0 37.0 41.0 31.0 41.0 45 37.17075 40.0 37.0 41.0 30.0 41.0 46 36.9385 40.0 36.0 41.0 30.0 41.0 47 36.90825 40.0 36.0 41.0 30.0 41.0 48 36.7775 40.0 36.0 41.0 30.0 41.0 49 36.6415 40.0 36.0 41.0 29.0 41.0 50 36.7785 39.0 36.0 41.0 30.0 41.0 51 36.65 39.0 36.0 41.0 29.0 41.0 52 34.688 38.0 33.0 40.0 24.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 5.0 23 7.0 24 11.0 25 15.0 26 26.0 27 26.0 28 36.0 29 38.0 30 63.0 31 69.0 32 98.0 33 120.0 34 117.0 35 183.0 36 275.0 37 436.0 38 827.0 39 1640.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.48037889039242 10.744248985115021 5.520974289580514 48.25439783491204 2 22.925 13.8 35.699999999999996 27.575 3 20.45 17.549999999999997 23.1 38.9 4 26.075 25.900000000000002 20.05 27.975 5 24.224999999999998 30.85 22.925 22.0 6 18.75 32.175 24.925 24.15 7 14.575 24.224999999999998 41.05 20.150000000000002 8 17.8 22.55 30.875000000000004 28.775000000000002 9 17.25 21.125 33.900000000000006 27.725 10 19.15 39.125 22.675 19.05 11 20.9 30.95 21.075 27.075 12 21.85 25.75 25.275 27.125 13 19.225 26.724999999999998 28.675 25.374999999999996 14 19.625 27.700000000000003 28.7 23.974999999999998 15 20.7 26.8 26.5 26.0 16 19.8 28.225 26.325 25.650000000000002 17 21.975 28.225 25.650000000000002 24.15 18 20.575 27.224999999999998 24.8 27.400000000000002 19 20.65 29.099999999999998 25.124999999999996 25.124999999999996 20 21.224999999999998 26.525 27.150000000000002 25.1 21 21.224999999999998 27.35 25.6 25.825 22 19.975 29.25 25.525 25.25 23 22.075 28.65 24.95 24.325 24 21.575 25.874999999999996 25.224999999999998 27.325 25 20.549999999999997 27.6 25.3 26.55 26 22.275 26.450000000000003 26.900000000000002 24.375 27 20.875 26.150000000000002 27.025 25.95 28 21.8 28.1 26.924999999999997 23.175 29 20.95 26.825 28.249999999999996 23.974999999999998 30 19.650000000000002 26.125 27.650000000000002 26.575 31 19.85 27.55 27.35 25.25 32 21.224999999999998 26.450000000000003 27.224999999999998 25.1 33 19.975 25.025 26.575 28.425 34 20.05 27.3 26.275 26.375 35 20.9 26.174999999999997 26.275 26.650000000000002 36 20.825 26.924999999999997 25.95 26.3 37 20.474999999999998 26.424999999999997 26.275 26.825 38 21.475 25.05 26.200000000000003 27.275 39 21.775 26.1 24.175 27.950000000000003 40 21.0 26.424999999999997 26.650000000000002 25.924999999999997 41 20.75 26.1 26.275 26.875 42 20.599999999999998 25.924999999999997 27.075 26.400000000000002 43 22.025 26.1 25.224999999999998 26.650000000000002 44 21.775 27.875 26.35 24.0 45 22.85 24.5 26.900000000000002 25.75 46 24.075 26.025 24.725 25.174999999999997 47 22.975 25.55 25.074999999999996 26.400000000000002 48 22.45 25.15 24.45 27.950000000000003 49 20.525 27.400000000000002 24.325 27.750000000000004 50 22.775000000000002 26.575 25.0 25.650000000000002 51 21.3 26.1 26.1 26.5 52 22.175 27.400000000000002 25.3 25.124999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 2.5 17 4.0 18 4.5 19 5.0 20 6.0 21 7.0 22 7.0 23 7.0 24 10.0 25 13.0 26 16.5 27 20.0 28 27.5 29 35.0 30 39.0 31 43.0 32 57.0 33 71.0 34 99.0 35 127.0 36 154.5 37 182.0 38 195.5 39 222.0 40 235.0 41 262.0 42 289.0 43 299.5 44 310.0 45 316.5 46 323.0 47 319.0 48 315.0 49 329.5 50 344.0 51 350.5 52 357.0 53 345.5 54 334.0 55 260.5 56 187.0 57 179.0 58 171.0 59 160.0 60 149.0 61 119.5 62 90.0 63 71.0 64 50.5 65 49.0 66 37.0 67 25.0 68 22.0 69 19.0 70 15.5 71 12.0 72 7.5 73 3.0 74 4.0 75 5.0 76 3.5 77 2.0 78 2.0 79 2.0 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.03899721448468 84.39999999999999 2 3.9275766016713094 7.049999999999999 3 0.7520891364902507 2.025 4 0.4735376044568245 1.7000000000000002 5 0.3342618384401114 1.5 6 0.25069637883008355 1.35 7 0.02785515320334262 0.17500000000000002 8 0.02785515320334262 0.2 9 0.05571030640668524 0.44999999999999996 >10 0.11142061281337048 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 14 0.35000000000000003 No Hit CTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGCA 12 0.3 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 10 0.25 No Hit CTCGGTTGCTGGAACCTCCATGACTCCAGTGTAGACATGGCTCTTCTCAGTC 10 0.25 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 9 0.22499999999999998 No Hit CTCAGCCTGGAATACAATCATAAAGTTAAAAGTACCAGAGATTCCTAGAGGC 9 0.22499999999999998 No Hit CTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCATGTA 8 0.2 No Hit GTCCTAGAAGTGCATGATAAATACCGCCAAAGCCCAATACTGCAGAGGAAAT 7 0.17500000000000002 No Hit CGCAGAAGTAGGAATAATGGCACCAGAAATGATATTGTTTCCATAAAGTAGA 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 6 0.15 No Hit CCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCCCT 6 0.15 No Hit CTCGGGTCCTAGAAGTGCATGATAAATACCGCCAAAGCCCAATACTGCAGAG 6 0.15 No Hit GCCGACTCCAACTATCGTCCATGTACGATCCATACTAGATCTGACCAACTGC 6 0.15 No Hit CCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGC 6 0.15 No Hit GTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGATG 6 0.15 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 6 0.15 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 6 0.15 No Hit CAGGGCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAG 5 0.125 No Hit GCTCAGCCTGGAATACAATCATAAAGTTAAAAGTACCAGAGATTCCTAGAGG 5 0.125 No Hit CTCACGAGCAAGATCACGTCCCTCATTACGAGCTTGTACACATGCTTCTAGA 5 0.125 No Hit GTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCG 5 0.125 No Hit GTTAATAATATCAGCCCAGGTATTAATTACACGACCTTGACTATCAACTACA 5 0.125 No Hit GTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCA 5 0.125 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit CCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACTGG 5 0.125 No Hit CATAAGGATGTTGTGCTCAGCCTGGAATACAATCATAAAGTTAAAAGTACCA 5 0.125 No Hit ATCAAACTAGAGGTTACCAAAGAACCATGCATAGCACTGAATAGGGAGCCGC 5 0.125 No Hit AAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGATGTC 5 0.125 No Hit GCCAGATACAAAGTATGGAAAGGTGTCTATGACTTCCCCGCCAGGACCCACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra Read 200000 spots for SRR5423453.sra Written 200000 spots for SRR5423453.sra SRR ids: ['SRR5423453.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_48ij2hsg SRR5423453.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423453 file size 703984 SRR5423453 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423453 SRR5423453_1.fastq Input file: SRR5423453_1.fastq trimmed: SRR5423453-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:07:33 2025 >> started Wed Feb 12 15:07:36 2025 >> done (2.545s) 4000000 reads processed; of these: 143 ( 0.00%) short reads filtered out after trimming by size control 202 ( 0.01%) empty reads filtered out after trimming by size control 3999655 (99.99%) reads available; of these: 93677 ( 2.34%) trimmed reads available after processing 3905978 (97.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 5 0.00% 28 1 0.00% 29 5 0.00% 30 1 0.00% 31 7 0.00% 32 4 0.00% 33 9 0.00% 34 18 0.00% 35 15 0.00% 36 34 0.00% 37 36 0.00% 38 33 0.00% 39 43 0.00% 40 70 0.00% 41 76 0.00% 42 124 0.00% 43 144 0.00% 44 317 0.01% 45 404 0.01% 46 614 0.02% 47 905 0.02% 48 1777 0.04% 49 4181 0.10% 50 12050 0.30% 51 72781 1.82% 52 3905978 97.66% 3999655 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=6.53 fanout-score-rank=9 prefix-density=0.80 prefix-fanout=1.5 sequence=ACGTGCTTAATACGTGCTTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=62.43 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=1.1 sequence=CCCCTCTGCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAG Started job on | Feb 12 15:07:50 Started mapping on | Feb 12 15:07:50 Finished on | Feb 12 15:07:59 Mapping speed, Million of reads per hour | 1599.86 Number of input reads | 3999655 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3145094 Uniquely mapped reads % | 78.63% Average mapped length | 51.73 Number of splices: Total | 300393 Number of splices: Annotated (sjdb) | 295638 Number of splices: GT/AG | 293868 Number of splices: GC/AG | 5210 Number of splices: AT/AC | 820 Number of splices: Non-canonical | 495 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 675821 % of reads mapped to multiple loci | 16.90% Number of reads mapped to too many loci | 105291 % of reads mapped to too many loci | 2.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.83% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 178740 178740 178740 N_multimapping 675821 675821 675821 N_noFeature 408264 3098512 444575 N_ambiguous 19643 128 9259 UnstrandedReadsAssigned:2717187 PositiveStrandReadsAssigned:46454 NegativeStrandReadsAssigned:2691260 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423453 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423453-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,655 reads, 3,265,303 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,257 rounds 52401 SRR5423453.ke.tsv 34699 SRR5423453.se.tsv 87100 total ==> SRR5423453.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 136 19.2524 Potri.005G024800.1.v4.1 1035 936 18 5.22419 Potri.004G059700.1.v4.1 961 862 3 0.945444 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 63 6.01773 Potri.016G087400.1.v4.1 270 171 7 11.1205 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.324561 Potri.012G127500.1.v4.1 977 878 5 1.54703 ==> SRR5423453.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 43 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423453 completed mapping pipeline successfully