Starting /dee2/code/volunteer_pipeline.sh SRR5423454 current disk space = 3092836028416 free memory = 1572117060 SRR5423454 SRAfilesize a19852d6644437885b4bf5c5c6a24229 SRR5423454.sra SRR5423454.sra file validated SRR5423454 is single end SRR5423454 is conventional basespace SRR5423454 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423454_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.4905 34.0 31.0 34.0 28.0 34.0 2 31.70725 34.0 31.0 34.0 28.0 34.0 3 32.644 34.0 31.0 34.0 30.0 34.0 4 36.1605 37.0 35.0 37.0 35.0 37.0 5 36.14175 37.0 35.0 37.0 35.0 37.0 6 36.3285 37.0 37.0 37.0 35.0 37.0 7 36.285 37.0 37.0 37.0 35.0 37.0 8 36.23575 37.0 37.0 37.0 35.0 37.0 9 38.053 39.0 39.0 39.0 37.0 39.0 10 38.086 39.0 38.0 39.0 37.0 39.0 11 38.128 39.0 39.0 39.0 37.0 39.0 12 38.063 39.0 38.0 39.0 37.0 39.0 13 38.0525 39.0 38.0 39.0 35.0 39.0 14 39.61125 41.0 40.0 41.0 37.0 41.0 15 39.529 41.0 39.0 41.0 37.0 41.0 16 39.4915 41.0 39.0 41.0 37.0 41.0 17 39.4395 41.0 39.0 41.0 36.0 41.0 18 39.5075 41.0 39.0 41.0 37.0 41.0 19 39.49775 41.0 39.0 41.0 37.0 41.0 20 39.467 41.0 39.0 41.0 37.0 41.0 21 39.40325 41.0 39.0 41.0 36.0 41.0 22 39.3615 41.0 39.0 41.0 36.0 41.0 23 39.41075 41.0 39.0 41.0 37.0 41.0 24 39.3995 41.0 39.0 41.0 37.0 41.0 25 39.30775 41.0 39.0 41.0 36.0 41.0 26 39.32375 41.0 39.0 41.0 36.0 41.0 27 39.2185 41.0 39.0 41.0 36.0 41.0 28 39.16825 41.0 39.0 41.0 36.0 41.0 29 39.20525 41.0 39.0 41.0 36.0 41.0 30 39.116 40.0 39.0 41.0 36.0 41.0 31 39.12075 41.0 39.0 41.0 36.0 41.0 32 39.093 40.0 39.0 41.0 36.0 41.0 33 39.05075 40.0 39.0 41.0 36.0 41.0 34 39.03775 40.0 39.0 41.0 36.0 41.0 35 39.001 40.0 39.0 41.0 36.0 41.0 36 38.8495 40.0 39.0 41.0 35.0 41.0 37 38.82875 40.0 38.0 41.0 35.0 41.0 38 38.84225 40.0 38.0 41.0 35.0 41.0 39 38.769 40.0 38.0 41.0 35.0 41.0 40 38.599 40.0 38.0 41.0 35.0 41.0 41 38.4725 40.0 38.0 41.0 34.0 41.0 42 38.43075 40.0 38.0 41.0 34.0 41.0 43 38.39325 40.0 38.0 41.0 34.0 41.0 44 38.36325 40.0 38.0 41.0 33.0 41.0 45 38.0585 40.0 38.0 41.0 33.0 41.0 46 38.00475 40.0 38.0 41.0 33.0 41.0 47 37.97525 40.0 38.0 41.0 33.0 41.0 48 38.06725 40.0 38.0 41.0 33.0 41.0 49 37.91375 40.0 38.0 41.0 33.0 41.0 50 37.8525 40.0 37.0 41.0 33.0 41.0 51 37.76375 40.0 37.0 41.0 32.0 41.0 52 36.11825 38.0 35.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 3.0 23 6.0 24 5.0 25 6.0 26 7.0 27 6.0 28 18.0 29 22.0 30 33.0 31 40.0 32 60.0 33 80.0 34 114.0 35 148.0 36 239.0 37 369.0 38 776.0 39 2052.0 40 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.85022979183563 14.220059475533928 5.001351716680183 34.92835901595026 2 21.325 15.15 35.775 27.750000000000004 3 17.8 20.65 27.05 34.5 4 21.825 29.7 24.775 23.7 5 22.475 33.125 24.025 20.375 6 19.875 31.225 24.825 24.075 7 15.049999999999999 22.025 42.3 20.625 8 17.175 21.575 31.125000000000004 30.125 9 18.325 20.375 32.75 28.549999999999997 10 20.5 35.199999999999996 24.275 20.025000000000002 11 25.6 24.025 20.275000000000002 30.099999999999998 12 21.8 22.525000000000002 26.700000000000003 28.975 13 21.0 25.85 28.050000000000004 25.1 14 21.45 26.224999999999998 26.6 25.724999999999998 15 20.599999999999998 25.124999999999996 25.924999999999997 28.349999999999998 16 21.2 26.3 26.75 25.75 17 21.25 25.424999999999997 27.325 26.0 18 21.15 25.6 25.575 27.675 19 21.25 26.875 25.525 26.35 20 23.025000000000002 25.7 25.45 25.825 21 21.325 24.875 26.825 26.974999999999998 22 22.525000000000002 25.674999999999997 26.900000000000002 24.9 23 21.675 25.275 27.725 25.324999999999996 24 21.8 25.650000000000002 24.65 27.900000000000002 25 20.549999999999997 26.924999999999997 26.924999999999997 25.6 26 21.95 24.9 27.3 25.85 27 20.75 24.825 26.575 27.85 28 22.225 26.25 25.95 25.575 29 22.35 26.424999999999997 26.35 24.875 30 22.6 25.474999999999998 25.275 26.650000000000002 31 21.65 26.5 25.5 26.35 32 22.75 24.474999999999998 27.425 25.35 33 22.6 24.625 25.8 26.974999999999998 34 20.775 26.650000000000002 26.075 26.5 35 22.625 23.925 27.200000000000003 26.25 36 22.25 24.925 25.124999999999996 27.700000000000003 37 21.4 25.5 26.325 26.775 38 21.975 26.125 26.325 25.575 39 21.9 25.1 24.875 28.125 40 22.6 23.599999999999998 27.0 26.8 41 21.9 25.25 26.974999999999998 25.874999999999996 42 22.0 25.45 25.5 27.05 43 22.400000000000002 25.1 26.55 25.95 44 22.475 25.0 25.7 26.825 45 21.45 26.55 26.400000000000002 25.6 46 23.200000000000003 25.124999999999996 25.674999999999997 26.0 47 23.25 23.95 27.075 25.724999999999998 48 21.675 23.75 26.674999999999997 27.900000000000002 49 21.925 25.900000000000002 25.25 26.924999999999997 50 22.680670167541887 25.881470367591895 25.70642660665166 25.731432858214554 51 21.8 24.0 27.200000000000003 27.0 52 22.525000000000002 24.175 25.874999999999996 27.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.5 21 5.0 22 4.0 23 3.0 24 9.5 25 16.0 26 14.5 27 13.0 28 18.0 29 23.0 30 31.5 31 40.0 32 61.0 33 82.0 34 83.5 35 85.0 36 96.0 37 107.0 38 138.0 39 190.5 40 212.0 41 228.5 42 245.0 43 283.0 44 321.0 45 344.0 46 367.0 47 376.5 48 386.0 49 397.0 50 408.0 51 383.5 52 359.0 53 337.5 54 316.0 55 282.0 56 248.0 57 222.0 58 196.0 59 175.5 60 155.0 61 115.0 62 75.0 63 71.0 64 53.5 65 40.0 66 31.0 67 22.0 68 18.0 69 14.0 70 11.0 71 8.0 72 7.5 73 7.0 74 5.0 75 3.0 76 2.5 77 2.0 78 1.5 79 1.0 80 1.5 81 2.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5794910556815319 1.15 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATTCTTAAGGTATATATCGGCAGAGGAGCCCCTTCCTCCGAAGACGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra Read 200000 spots for SRR5423454.sra Written 200000 spots for SRR5423454.sra SRR ids: ['SRR5423454.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lit7zwgq SRR5423454.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423454 file size 703963 SRR5423454 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423454 SRR5423454_1.fastq Input file: SRR5423454_1.fastq trimmed: SRR5423454-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 09:14:38 2025 >> started Thu Feb 13 09:26:24 2025 >> done (706.562s) 4000000 reads processed; of these: 236 ( 0.01%) short reads filtered out after trimming by size control 188 ( 0.00%) empty reads filtered out after trimming by size control 3999576 (99.99%) reads available; of these: 60071 ( 1.50%) trimmed reads available after processing 3939505 (98.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 10 0.00% 20 8 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 5 0.00% 26 5 0.00% 27 3 0.00% 28 4 0.00% 29 7 0.00% 30 10 0.00% 31 15 0.00% 32 21 0.00% 33 20 0.00% 34 21 0.00% 35 19 0.00% 36 30 0.00% 37 37 0.00% 38 24 0.00% 39 42 0.00% 40 63 0.00% 41 88 0.00% 42 105 0.00% 43 178 0.00% 44 194 0.00% 45 260 0.01% 46 413 0.01% 47 543 0.01% 48 968 0.02% 49 2187 0.05% 50 6187 0.15% 51 48590 1.21% 52 3939505 98.50% 3999576 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=25 prefix-density=0.20 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=82.09 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.4 sequence=ACAGCAGCACTCGATGTATCCACAAATGTGGCATTGAATCTATTGGCAAGGAATTCGCCATATGCTGCATTCTTAAGGTATATATCGGCAGAGGAGCCCCTTCCTCCGAAGACGATTTCCGGCGTGTTCTCTAAGCAATTCGTCTCGGTTATCTCATTTACACACTCTTGCAACTTCAAACCCTGCAGCTCAGAGGCAACCGCAAGCCAGTTTGAATCGACGGGAAGCCACAACAGGTTCTGTGATGGGTTCCCGGAAGTATACAGTTTTACTTTCTGAAAATCTGCGCTTCCCAAGGAATTGACTCCTTTCTGTGGAAGATTGAAGTCTCCGAATTTGAGTTTCCCTCTCGTTGACGCGTTGCTCTTCCATTCCCAATTTCCTGTGAAGGCAACAGACTCTGGCACAGCAACATCACCAAGACGCAACGAATCGCTGACACTTCCAGCACTCCCAAAATGAATGATTCCTCGGATGCTAAGTAAAT Started job on | Feb 13 09:39:41 Started mapping on | Feb 13 09:40:17 Finished on | Feb 13 10:30:03 Mapping speed, Million of reads per hour | 4.82 Number of input reads | 3999576 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3572340 Uniquely mapped reads % | 89.32% Average mapped length | 51.85 Number of splices: Total | 459188 Number of splices: Annotated (sjdb) | 453674 Number of splices: GT/AG | 450506 Number of splices: GC/AG | 7813 Number of splices: AT/AC | 393 Number of splices: Non-canonical | 476 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330397 % of reads mapped to multiple loci | 8.26% Number of reads mapped to too many loci | 81939 % of reads mapped to too many loci | 2.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 96839 96839 96839 N_multimapping 330397 330397 330397 N_noFeature 110727 3539276 124216 N_ambiguous 32146 44 12542 UnstrandedReadsAssigned:3429467 PositiveStrandReadsAssigned:33020 NegativeStrandReadsAssigned:3435582 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423454 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423454-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,576 reads, 3,689,451 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52401 SRR5423454.ke.tsv 34699 SRR5423454.se.tsv 87100 total ==> SRR5423454.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 68 10.8389 Potri.005G024800.1.v4.1 1035 936 4 1.30719 Potri.004G059700.1.v4.1 961 862 8 2.83881 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 67.9423 7.30742 Potri.016G087400.1.v4.1 270 171 131 234.33 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 3 0.548175 Potri.012G127500.1.v4.1 977 878 185 64.4511 ==> SRR5423454.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 84 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423454 completed mapping pipeline successfully