Starting /dee2/code/volunteer_pipeline.sh SRR5423455 current disk space = 3092797247488 free memory = 1572061228 SRR5423455 SRAfilesize e49a58d7a75e376db113b821617b3e2e SRR5423455.sra SRR5423455.sra file validated SRR5423455 is single end SRR5423455 is conventional basespace SRR5423455 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423455_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.803 31.0 31.0 34.0 30.0 34.0 2 32.033 33.0 31.0 34.0 30.0 34.0 3 32.0965 34.0 31.0 34.0 30.0 34.0 4 34.081 37.0 35.0 37.0 28.0 37.0 5 35.23875 37.0 35.0 37.0 32.0 37.0 6 35.491 37.0 35.0 37.0 33.0 37.0 7 35.63075 37.0 35.0 37.0 33.0 37.0 8 35.76275 37.0 35.0 37.0 33.0 37.0 9 37.44575 39.0 37.0 39.0 34.0 39.0 10 37.0455 39.0 37.0 39.0 33.0 39.0 11 37.22075 39.0 37.0 39.0 33.0 39.0 12 37.1705 39.0 37.0 39.0 33.0 39.0 13 37.262 39.0 37.0 39.0 34.0 39.0 14 38.516 40.0 38.0 41.0 34.0 41.0 15 38.52975 40.0 38.0 41.0 34.0 41.0 16 38.47275 40.0 38.0 41.0 34.0 41.0 17 38.22925 40.0 38.0 41.0 33.0 41.0 18 38.371 40.0 38.0 41.0 33.0 41.0 19 38.57 40.0 38.0 41.0 34.0 41.0 20 38.51125 40.0 38.0 41.0 34.0 41.0 21 38.48825 40.0 38.0 41.0 34.0 41.0 22 38.49625 40.0 38.0 41.0 34.0 41.0 23 38.472 40.0 38.0 41.0 34.0 41.0 24 38.4465 40.0 38.0 41.0 34.0 41.0 25 38.62625 40.0 38.0 41.0 34.0 41.0 26 38.55625 40.0 38.0 41.0 34.0 41.0 27 38.4215 40.0 38.0 41.0 34.0 41.0 28 38.48025 40.0 38.0 41.0 34.0 41.0 29 38.34525 40.0 38.0 41.0 34.0 41.0 30 38.293 40.0 38.0 41.0 34.0 41.0 31 38.35725 40.0 38.0 41.0 34.0 41.0 32 38.358 40.0 38.0 41.0 34.0 41.0 33 37.7695 40.0 37.0 41.0 32.0 41.0 34 38.00875 40.0 37.0 41.0 33.0 41.0 35 38.1015 40.0 38.0 41.0 33.0 41.0 36 38.22625 40.0 38.0 41.0 34.0 41.0 37 37.5935 40.0 37.0 41.0 31.0 41.0 38 37.7815 40.0 37.0 41.0 32.0 41.0 39 37.8825 40.0 37.0 41.0 33.0 41.0 40 37.98575 40.0 37.0 41.0 33.0 41.0 41 37.838 40.0 37.0 41.0 33.0 41.0 42 37.8785 40.0 37.0 41.0 33.0 41.0 43 37.44425 40.0 37.0 41.0 31.0 41.0 44 37.5585 40.0 37.0 41.0 32.0 41.0 45 37.54875 40.0 37.0 41.0 32.0 41.0 46 37.59325 40.0 37.0 41.0 32.0 41.0 47 37.3555 40.0 36.0 41.0 31.0 41.0 48 37.447 40.0 36.0 41.0 31.0 41.0 49 37.56975 40.0 37.0 41.0 32.0 41.0 50 37.265 39.0 36.0 41.0 31.0 41.0 51 37.391 40.0 36.0 41.0 31.0 41.0 52 36.65475 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1114 1 0.0 1114 2 0.0 1114 3 0.0 1114 4 0.0 1114 5 0.0 1114 6 0.0 1114 7 0.0 1114 8 0.0 1114 9 0.0 1114 10 0.0 1114 11 0.0 1114 12 0.0 1114 13 0.0 1114 14 0.0 1114 15 0.0 1114 16 0.0 1114 17 0.0 1114 18 0.0 1114 19 0.0 1114 20 0.0 1114 21 0.0 1114 22 0.0 1114 23 0.0 1114 24 0.0 1114 25 0.0 1114 26 0.0 1114 27 0.0 1114 28 0.0 1114 29 0.0 1114 30 0.0 1114 31 0.0 1114 32 0.0 1114 33 0.0 1114 34 0.0 1114 35 0.0 1114 36 0.0 1114 37 0.0 1114 38 0.0 1114 39 0.0 1114 40 0.0 1114 41 0.0 1114 42 0.0 1114 43 0.0 1114 44 0.0 1114 45 0.0 1114 46 0.0 1114 47 0.0 1114 48 0.0 1114 49 0.0 1114 50 0.0 1114 51 0.0 1114 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 6.0 25 8.0 26 15.0 27 13.0 28 33.0 29 48.0 30 58.0 31 87.0 32 125.0 33 134.0 34 179.0 35 227.0 36 310.0 37 476.0 38 718.0 39 1549.0 40 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.94188376753507 13.47695390781563 5.135270541082164 35.445891783567134 2 21.95 16.575 34.725 26.75 3 19.225 20.875 27.275 32.625 4 22.925 29.825000000000003 23.875 23.375 5 23.35 32.975 23.724999999999998 19.950000000000003 6 19.325 33.025 23.7 23.95 7 16.55 21.8 41.9 19.75 8 17.474999999999998 21.725 30.875000000000004 29.925 9 17.8 19.400000000000002 32.975 29.825000000000003 10 19.925 35.6 23.7 20.775 11 25.0 24.275 20.925 29.799999999999997 12 22.15 22.6 26.575 28.675 13 20.724999999999998 25.874999999999996 28.15 25.25 14 20.549999999999997 25.1 27.950000000000003 26.400000000000002 15 21.349999999999998 25.5 26.950000000000003 26.200000000000003 16 21.625 26.450000000000003 26.375 25.55 17 21.65 24.85 27.3 26.200000000000003 18 20.200000000000003 25.275 26.825 27.700000000000003 19 21.025 25.75 26.5 26.724999999999998 20 20.75 24.7 27.425 27.125 21 21.275 26.450000000000003 26.025 26.25 22 22.5 25.2 27.150000000000002 25.15 23 21.55 24.8 26.8 26.85 24 20.875 24.75 26.900000000000002 27.474999999999998 25 21.55 26.1 26.0 26.35 26 21.775 25.174999999999997 26.174999999999997 26.875 27 20.5 26.375 26.0 27.125 28 22.05 25.5 26.700000000000003 25.75 29 21.5 26.1 26.400000000000002 26.0 30 20.625 24.675 28.025 26.674999999999997 31 22.725 25.525 25.3 26.450000000000003 32 21.099999999999998 24.675 27.1 27.125 33 21.575 24.7 26.625 27.1 34 22.0 26.525 24.925 26.55 35 20.05 25.724999999999998 26.450000000000003 27.775 36 21.75 23.974999999999998 25.35 28.925 37 21.025 24.975 27.650000000000002 26.35 38 20.974999999999998 24.15 27.800000000000004 27.075 39 22.2 24.6 25.85 27.35 40 21.875 24.925 26.75 26.450000000000003 41 22.925 24.825 26.450000000000003 25.8 42 22.425 24.375 26.775 26.424999999999997 43 21.375 26.150000000000002 26.650000000000002 25.825 44 21.6 24.725 28.4 25.275 45 22.275 23.799999999999997 27.175 26.75 46 21.099999999999998 25.4 26.174999999999997 27.325 47 21.95 25.3 25.624999999999996 27.125 48 21.95 25.324999999999996 25.900000000000002 26.825 49 22.25 24.85 26.275 26.625 50 22.525000000000002 25.224999999999998 26.650000000000002 25.6 51 21.75 24.8 26.125 27.325 52 22.225 24.4 26.450000000000003 26.924999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 1.0 17 2.0 18 2.5 19 3.0 20 3.0 21 3.0 22 2.0 23 1.0 24 4.5 25 8.0 26 10.5 27 13.0 28 22.5 29 32.0 30 32.5 31 33.0 32 48.5 33 64.0 34 70.5 35 77.0 36 102.0 37 127.0 38 155.5 39 191.5 40 199.0 41 230.5 42 262.0 43 273.5 44 285.0 45 314.5 46 344.0 47 368.0 48 392.0 49 405.5 50 419.0 51 419.5 52 420.0 53 368.0 54 316.0 55 288.5 56 261.0 57 219.0 58 177.0 59 161.0 60 145.0 61 120.0 62 95.0 63 72.5 64 41.0 65 32.0 66 25.0 67 18.0 68 17.5 69 17.0 70 14.0 71 11.0 72 7.5 73 4.0 74 4.0 75 4.0 76 2.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03991915108641 98.0 2 0.8842849924204144 1.7500000000000002 3 0.05053057099545225 0.15 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra Read 200000 spots for SRR5423455.sra Written 200000 spots for SRR5423455.sra SRR ids: ['SRR5423455.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2wblj1b6 SRR5423455.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423455 file size 703980 SRR5423455 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423455 SRR5423455_1.fastq Input file: SRR5423455_1.fastq trimmed: SRR5423455-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 09:27:05 2025 >> started Thu Feb 13 09:31:47 2025 >> done (282.100s) 4000000 reads processed; of these: 282 ( 0.01%) short reads filtered out after trimming by size control 180 ( 0.00%) empty reads filtered out after trimming by size control 3999538 (99.99%) reads available; of these: 60801 ( 1.52%) trimmed reads available after processing 3938737 (98.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 9 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 3 0.00% 26 3 0.00% 27 6 0.00% 28 10 0.00% 29 11 0.00% 30 6 0.00% 31 10 0.00% 32 19 0.00% 33 10 0.00% 34 12 0.00% 35 27 0.00% 36 23 0.00% 37 41 0.00% 38 34 0.00% 39 36 0.00% 40 66 0.00% 41 106 0.00% 42 109 0.00% 43 141 0.00% 44 213 0.01% 45 294 0.01% 46 436 0.01% 47 662 0.02% 48 1058 0.03% 49 2340 0.06% 50 6840 0.17% 51 48252 1.21% 52 3938737 98.48% 3999538 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=27 prefix-density=0.19 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=146.65 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=13.7 sequence=TCCACCACCATGGGCTTGGTGGGAATCATCTTGATCATACCAGCATCACCGTTCTTCAGGAACTTGGGCTCCTTCTCCAGTTCCTTACCAGACCGCCTGTCAATCTTGGTGAGGATCTCAGCAAACTTCACAGCAATGTGACAGGTGTGGCAGTCAAG Started job on | Feb 13 09:34:41 Started mapping on | Feb 13 09:34:54 Finished on | Feb 13 09:46:31 Mapping speed, Million of reads per hour | 20.66 Number of input reads | 3999538 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3573100 Uniquely mapped reads % | 89.34% Average mapped length | 51.85 Number of splices: Total | 458554 Number of splices: Annotated (sjdb) | 453013 Number of splices: GT/AG | 449973 Number of splices: GC/AG | 7689 Number of splices: AT/AC | 361 Number of splices: Non-canonical | 531 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329278 % of reads mapped to multiple loci | 8.23% Number of reads mapped to too many loci | 82150 % of reads mapped to too many loci | 2.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 97160 97160 97160 N_multimapping 329278 329278 329278 N_noFeature 111015 3540373 124292 N_ambiguous 32052 48 12570 UnstrandedReadsAssigned:3430033 PositiveStrandReadsAssigned:32679 NegativeStrandReadsAssigned:3436238 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423455 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423455-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,538 reads, 3,690,429 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR5423455.ke.tsv 34699 SRR5423455.se.tsv 87100 total ==> SRR5423455.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 93 14.8294 Potri.005G024800.1.v4.1 1035 936 3 0.980758 Potri.004G059700.1.v4.1 961 862 7 2.48489 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 71 7.63915 Potri.016G087400.1.v4.1 270 171 183 327.47 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 3 0.548381 Potri.012G127500.1.v4.1 977 878 163 56.808 ==> SRR5423455.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 75 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423455 completed mapping pipeline successfully