Starting /dee2/code/volunteer_pipeline.sh SRR5423456 current disk space = 3092710838272 free memory = 1567305576 SRR5423456 SRAfilesize 6f8da1e925a26031155c18009435ea2d SRR5423456.sra SRR5423456.sra file validated SRR5423456 is single end SRR5423456 is conventional basespace SRR5423456 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423456_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2485 34.0 31.0 34.0 30.0 34.0 2 32.39175 34.0 31.0 34.0 30.0 34.0 3 32.46 34.0 31.0 34.0 30.0 34.0 4 35.708 37.0 35.0 37.0 33.0 37.0 5 35.6515 37.0 35.0 37.0 33.0 37.0 6 35.81725 37.0 35.0 37.0 35.0 37.0 7 35.878 37.0 35.0 37.0 35.0 37.0 8 35.81825 37.0 35.0 37.0 35.0 37.0 9 37.65875 39.0 37.0 39.0 35.0 39.0 10 37.5095 39.0 37.0 39.0 35.0 39.0 11 37.55525 39.0 37.0 39.0 35.0 39.0 12 37.5415 39.0 37.0 39.0 35.0 39.0 13 37.56 39.0 37.0 39.0 35.0 39.0 14 39.03825 40.0 38.0 41.0 35.0 41.0 15 38.807 40.0 38.0 41.0 35.0 41.0 16 38.8105 40.0 38.0 41.0 35.0 41.0 17 38.69825 40.0 38.0 41.0 34.0 41.0 18 38.7345 40.0 38.0 41.0 34.0 41.0 19 38.77325 40.0 38.0 41.0 34.0 41.0 20 38.8265 40.0 38.0 41.0 35.0 41.0 21 38.8075 40.0 38.0 41.0 34.0 41.0 22 38.9065 40.0 38.0 41.0 35.0 41.0 23 38.9325 40.0 38.0 41.0 35.0 41.0 24 38.87925 40.0 38.0 41.0 35.0 41.0 25 38.71975 40.0 38.0 41.0 34.0 41.0 26 38.64025 40.0 38.0 41.0 34.0 41.0 27 38.6965 40.0 38.0 41.0 35.0 41.0 28 38.69075 40.0 38.0 41.0 35.0 41.0 29 38.667 40.0 38.0 41.0 34.0 41.0 30 38.67425 40.0 38.0 41.0 34.0 41.0 31 38.57675 40.0 38.0 41.0 34.0 41.0 32 38.57625 40.0 38.0 41.0 34.0 41.0 33 38.516 40.0 38.0 41.0 34.0 41.0 34 38.54775 40.0 38.0 41.0 34.0 41.0 35 38.05225 40.0 38.0 41.0 33.0 41.0 36 38.16725 40.0 38.0 41.0 33.0 41.0 37 38.05575 40.0 37.0 41.0 33.0 41.0 38 38.008 40.0 38.0 41.0 33.0 41.0 39 38.12125 40.0 38.0 41.0 33.0 41.0 40 38.15725 40.0 37.0 41.0 33.0 41.0 41 38.20425 40.0 38.0 41.0 33.0 41.0 42 38.19075 40.0 38.0 41.0 33.0 41.0 43 38.07275 40.0 38.0 41.0 33.0 41.0 44 38.13525 40.0 38.0 41.0 33.0 41.0 45 37.8705 40.0 37.0 41.0 32.0 41.0 46 37.93075 40.0 37.0 41.0 33.0 41.0 47 37.82025 40.0 37.0 41.0 33.0 41.0 48 37.86225 40.0 37.0 41.0 33.0 41.0 49 37.74725 40.0 37.0 41.0 32.0 41.0 50 37.68 40.0 37.0 41.0 32.0 41.0 51 37.69475 40.0 37.0 41.0 33.0 41.0 52 36.597 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1211 1 0.0 1211 2 0.0 1211 3 0.0 1211 4 0.0 1211 5 0.0 1211 6 0.0 1211 7 0.0 1211 8 0.0 1211 9 0.0 1211 10 0.0 1211 11 0.0 1211 12 0.0 1211 13 0.0 1211 14 0.0 1211 15 0.0 1211 16 0.0 1211 17 0.0 1211 18 0.0 1211 19 0.0 1211 20 0.0 1211 21 0.0 1211 22 0.0 1211 23 0.0 1211 24 0.0 1211 25 0.0 1211 26 0.0 1211 27 0.0 1211 28 0.0 1211 29 0.0 1211 30 0.0 1211 31 0.0 1211 32 0.0 1211 33 0.0 1211 34 0.0 1211 35 0.0 1211 36 0.0 1211 37 0.0 1211 38 0.0 1211 39 0.0 1211 40 0.0 1211 41 0.0 1211 42 0.0 1211 43 0.0 1211 44 0.0 1211 45 0.0 1211 46 0.0 1211 47 0.0 1211 48 0.0 1211 49 0.0 1211 50 0.0 1211 51 0.0 1211 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 2.0 21 1.0 22 2.0 23 0.0 24 4.0 25 2.0 26 18.0 27 10.0 28 29.0 29 36.0 30 47.0 31 75.0 32 79.0 33 99.0 34 155.0 35 206.0 36 295.0 37 411.0 38 689.0 39 1823.0 40 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.661654135338345 13.508771929824562 5.68922305764411 36.140350877192986 2 21.925 16.125 35.25 26.700000000000003 3 18.4 21.6 27.500000000000004 32.5 4 24.85 27.450000000000003 23.200000000000003 24.5 5 23.474999999999998 32.9 23.7 19.925 6 19.8 33.050000000000004 23.724999999999998 23.425 7 15.2 20.9 43.05 20.849999999999998 8 17.775 20.875 30.5 30.85 9 18.75 19.975 32.550000000000004 28.725 10 20.549999999999997 35.05 24.85 19.55 11 25.85 24.825 20.65 28.675 12 22.225 21.0 26.650000000000002 30.125 13 21.125 26.150000000000002 28.449999999999996 24.275 14 22.175 24.175 27.625 26.025 15 20.4 24.825 26.275 28.499999999999996 16 22.2 26.0 26.55 25.25 17 21.875 25.174999999999997 27.900000000000002 25.05 18 21.075 25.05 26.950000000000003 26.924999999999997 19 21.275 25.95 26.55 26.224999999999998 20 21.775 25.85 26.05 26.325 21 20.8 25.8 27.500000000000004 25.900000000000002 22 22.2 24.825 26.6 26.375 23 21.05 26.1 27.400000000000002 25.45 24 21.725 25.05 26.424999999999997 26.8 25 22.275 26.075 23.875 27.775 26 21.775 26.700000000000003 25.525 26.0 27 20.45 25.825 27.35 26.375 28 22.650000000000002 24.8 26.950000000000003 25.6 29 21.375 25.974999999999998 25.650000000000002 27.0 30 22.15 24.875 27.3 25.674999999999997 31 22.5 24.725 25.45 27.325 32 21.375 24.275 27.025 27.325 33 21.224999999999998 23.925 27.800000000000004 27.05 34 22.325 25.374999999999996 25.724999999999998 26.575 35 23.75 25.85 24.15 26.25 36 22.95 24.05 25.874999999999996 27.125 37 22.475 25.275 25.275 26.974999999999998 38 23.025000000000002 24.875 27.0 25.1 39 23.125 24.3 26.400000000000002 26.174999999999997 40 22.95 25.3 25.124999999999996 26.625 41 22.85 24.2 26.325 26.625 42 20.8 24.725 26.85 27.625 43 22.325 25.35 26.275 26.05 44 22.1 24.625 25.525 27.750000000000004 45 22.3 24.05 25.8 27.85 46 21.675 25.15 27.35 25.825 47 22.95 24.0 26.25 26.8 48 22.725 23.75 26.674999999999997 26.85 49 22.225 25.174999999999997 25.224999999999998 27.375 50 22.75 24.6 26.575 26.075 51 23.06153076538269 23.011505752876438 27.388694347173587 26.538269134567283 52 23.5 25.15 24.45 26.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.5 21 4.0 22 4.0 23 4.0 24 6.5 25 9.0 26 11.5 27 14.0 28 21.5 29 29.0 30 29.5 31 30.0 32 33.0 33 36.0 34 57.5 35 79.0 36 94.5 37 110.0 38 135.5 39 184.0 40 207.0 41 220.0 42 233.0 43 280.0 44 327.0 45 338.0 46 349.0 47 373.0 48 397.0 49 396.0 50 395.0 51 384.5 52 374.0 53 361.0 54 348.0 55 321.5 56 295.0 57 249.0 58 203.0 59 176.0 60 149.0 61 115.0 62 81.0 63 72.5 64 52.0 65 40.0 66 33.5 67 27.0 68 21.0 69 15.0 70 12.5 71 10.0 72 7.0 73 4.0 74 3.0 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.05 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra Read 200000 spots for SRR5423456.sra Written 200000 spots for SRR5423456.sra SRR ids: ['SRR5423456.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kaczweb8 SRR5423456.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423456 file size 704012 SRR5423456 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423456 SRR5423456_1.fastq Input file: SRR5423456_1.fastq trimmed: SRR5423456-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 09:47:14 2025 >> started Thu Feb 13 09:56:45 2025 >> done (570.259s) 4000000 reads processed; of these: 300 ( 0.01%) short reads filtered out after trimming by size control 172 ( 0.00%) empty reads filtered out after trimming by size control 3999528 (99.99%) reads available; of these: 55584 ( 1.39%) trimmed reads available after processing 3943944 (98.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 12 0.00% 20 12 0.00% 21 3 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 2 0.00% 26 4 0.00% 27 3 0.00% 28 4 0.00% 29 4 0.00% 30 15 0.00% 31 9 0.00% 32 23 0.00% 33 14 0.00% 34 9 0.00% 35 22 0.00% 36 22 0.00% 37 33 0.00% 38 43 0.00% 39 42 0.00% 40 71 0.00% 41 75 0.00% 42 77 0.00% 43 116 0.00% 44 201 0.01% 45 244 0.01% 46 362 0.01% 47 576 0.01% 48 908 0.02% 49 1919 0.05% 50 5999 0.15% 51 44746 1.12% 52 3943944 98.61% 3999528 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=25 prefix-density=0.21 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=76.37 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.2 sequence=ACAGCAGCACTCGATGTATCCACAAATGTGGCATTGAATCTATTGGCAAGGAATTCGCCATATGCTGCATTCTTAAGGTATATATCGGCAGAGGAGCCCCTTCCTCCGAAGACGATTTCCGGCGTGTTCTCTAAGCAATTCGTCTCGGTTATCTCATTTACACACTCTTGCAACTTCAAACCCTGCAGCTCAGAGGCAACCGCAAGCCAGTTTGAATCGACGGGAAGCCACAACAGGTTCTGTGATGGGTTCCCGGAAGTATACAGTTTTACTTTCTGAAAATCTGCGCTTCCCAAGGAATTGACTCCTTTCTGTGGAAGATTGAAGTCTCCGAATTTGAGTTTCCCTCTCGTTGACGCGTTGCTCTTCCATTCCCAATTTCCTGTGAAGGCAACAGACTCTGGCACAGCAACATCACCAAGACGCAACGAATCGCTGACACTTCCAGCACTCCCAAAATGAATGATTCCTCGGAT Started job on | Feb 13 10:03:33 Started mapping on | Feb 13 10:03:41 Finished on | Feb 13 10:35:51 Mapping speed, Million of reads per hour | 7.46 Number of input reads | 3999528 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3573407 Uniquely mapped reads % | 89.35% Average mapped length | 51.85 Number of splices: Total | 459627 Number of splices: Annotated (sjdb) | 454159 Number of splices: GT/AG | 450977 Number of splices: GC/AG | 7771 Number of splices: AT/AC | 365 Number of splices: Non-canonical | 514 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329404 % of reads mapped to multiple loci | 8.24% Number of reads mapped to too many loci | 82041 % of reads mapped to too many loci | 2.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 96717 96717 96717 N_multimapping 329404 329404 329404 N_noFeature 110625 3540439 124099 N_ambiguous 32056 57 12523 UnstrandedReadsAssigned:3430726 PositiveStrandReadsAssigned:32911 NegativeStrandReadsAssigned:3436785 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423456 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423456-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,528 reads, 3,691,897 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52401 SRR5423456.ke.tsv 34699 SRR5423456.se.tsv 87100 total ==> SRR5423456.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 82 13.0794 Potri.005G024800.1.v4.1 1035 936 8 2.61616 Potri.004G059700.1.v4.1 961 862 13 4.61622 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 58.1888 6.26269 Potri.016G087400.1.v4.1 270 171 200 358.001 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 5 0.91425 Potri.012G127500.1.v4.1 977 878 175 61.009 ==> SRR5423456.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 98 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423456 completed mapping pipeline successfully