Starting /dee2/code/volunteer_pipeline.sh SRR5423457 current disk space = 3092727562240 free memory = 1446752032 SRR5423457 SRAfilesize 8e2e2938165bc0c882704896defdd1e5 SRR5423457.sra SRR5423457.sra file validated SRR5423457 is single end SRR5423457 is conventional basespace SRR5423457 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423457_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42625 34.0 31.0 34.0 31.0 34.0 2 32.52875 34.0 31.0 34.0 31.0 34.0 3 32.527 34.0 31.0 34.0 31.0 34.0 4 35.99125 37.0 35.0 37.0 35.0 37.0 5 36.0035 37.0 35.0 37.0 35.0 37.0 6 35.99925 37.0 35.0 37.0 35.0 37.0 7 36.0695 37.0 35.0 37.0 35.0 37.0 8 36.067 37.0 35.0 37.0 35.0 37.0 9 37.95975 39.0 38.0 39.0 35.0 39.0 10 37.8 39.0 38.0 39.0 35.0 39.0 11 37.7235 39.0 38.0 39.0 35.0 39.0 12 37.739 39.0 38.0 39.0 35.0 39.0 13 37.7985 39.0 38.0 39.0 35.0 39.0 14 39.1035 40.0 38.0 41.0 36.0 41.0 15 39.142 40.0 38.0 41.0 36.0 41.0 16 38.97225 40.0 38.0 41.0 35.0 41.0 17 38.95975 40.0 38.0 41.0 36.0 41.0 18 39.052 40.0 38.0 41.0 36.0 41.0 19 39.0505 40.0 39.0 41.0 36.0 41.0 20 38.98 40.0 39.0 41.0 35.0 41.0 21 38.938 40.0 39.0 41.0 35.0 41.0 22 38.95775 40.0 39.0 41.0 35.0 41.0 23 38.989 40.0 39.0 41.0 36.0 41.0 24 38.81425 40.0 38.0 41.0 34.0 41.0 25 38.956 40.0 39.0 41.0 35.0 41.0 26 38.85725 40.0 38.0 41.0 35.0 41.0 27 38.693 40.0 38.0 41.0 34.0 41.0 28 38.6935 40.0 38.0 41.0 34.0 41.0 29 38.825 40.0 38.0 41.0 35.0 41.0 30 38.6245 40.0 38.0 41.0 35.0 41.0 31 38.73775 40.0 38.0 41.0 35.0 41.0 32 38.6195 40.0 38.0 41.0 34.0 41.0 33 38.7405 40.0 38.0 41.0 35.0 41.0 34 38.60075 40.0 38.0 41.0 35.0 41.0 35 38.555 40.0 38.0 41.0 34.0 41.0 36 38.59775 40.0 38.0 41.0 34.0 41.0 37 38.56925 40.0 38.0 41.0 34.0 41.0 38 38.47025 40.0 38.0 41.0 34.0 41.0 39 38.3295 40.0 38.0 41.0 34.0 41.0 40 38.3515 40.0 38.0 41.0 34.0 41.0 41 38.3135 40.0 38.0 41.0 33.0 41.0 42 38.16125 40.0 38.0 41.0 33.0 41.0 43 38.13725 40.0 38.0 41.0 33.0 41.0 44 38.1225 40.0 38.0 41.0 33.0 41.0 45 37.94325 40.0 37.0 41.0 33.0 41.0 46 37.9715 40.0 37.0 41.0 33.0 41.0 47 37.798 40.0 37.0 41.0 33.0 41.0 48 37.8585 40.0 37.0 41.0 33.0 41.0 49 37.989 40.0 37.0 41.0 33.0 41.0 50 37.71525 40.0 37.0 41.0 33.0 41.0 51 37.61075 40.0 37.0 41.0 32.0 41.0 52 36.50925 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1307 1 0.0 1307 2 0.0 1307 3 0.0 1307 4 0.0 1307 5 0.0 1307 6 0.0 1307 7 0.0 1307 8 0.0 1307 9 0.0 1307 10 0.0 1307 11 0.0 1307 12 0.0 1307 13 0.0 1307 14 0.0 1307 15 0.0 1307 16 0.0 1307 17 0.0 1307 18 0.0 1307 19 0.0 1307 20 0.0 1307 21 0.0 1307 22 0.0 1307 23 0.0 1307 24 0.0 1307 25 0.0 1307 26 0.0 1307 27 0.0 1307 28 0.0 1307 29 0.0 1307 30 0.0 1307 31 0.0 1307 32 0.0 1307 33 0.0 1307 34 0.0 1307 35 0.0 1307 36 0.0 1307 37 0.0 1307 38 0.0 1307 39 0.0 1307 40 0.0 1307 41 0.0 1307 42 0.0 1307 43 0.0 1307 44 0.0 1307 45 0.0 1307 46 0.0 1307 47 0.0 1307 48 0.0 1307 49 0.0 1307 50 0.0 1307 51 0.0 1307 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 2.0 23 2.0 24 3.0 25 8.0 26 10.0 27 22.0 28 25.0 29 33.0 30 45.0 31 63.0 32 61.0 33 106.0 34 123.0 35 181.0 36 240.0 37 403.0 38 674.0 39 1984.0 40 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.92991239048811 14.993742177722153 5.206508135168962 35.86983729662078 2 22.125 16.075 36.25 25.55 3 18.8 21.975 27.275 31.95 4 23.150000000000002 28.599999999999998 24.075 24.175 5 23.599999999999998 33.074999999999996 22.55 20.775 6 18.525 32.800000000000004 23.775 24.9 7 16.125 20.875 42.225 20.775 8 18.125 21.425 30.4 30.049999999999997 9 18.45 20.275000000000002 31.674999999999997 29.599999999999998 10 19.15 36.1 23.474999999999998 21.275 11 25.124999999999996 24.825 21.224999999999998 28.825 12 22.400000000000002 21.725 25.624999999999996 30.25 13 20.025000000000002 25.575 27.900000000000002 26.5 14 21.275 25.224999999999998 27.3 26.200000000000003 15 22.075 24.75 26.5 26.674999999999997 16 21.175 25.374999999999996 25.900000000000002 27.55 17 21.075 25.174999999999997 26.85 26.900000000000002 18 21.7 25.424999999999997 26.224999999999998 26.650000000000002 19 21.75 25.825 25.45 26.974999999999998 20 21.575 25.900000000000002 26.950000000000003 25.575 21 21.55 24.474999999999998 25.624999999999996 28.349999999999998 22 20.65 25.474999999999998 27.0 26.875 23 20.875 25.424999999999997 26.650000000000002 27.05 24 20.45 26.575 25.7 27.275 25 22.2 25.474999999999998 25.525 26.8 26 21.6 25.874999999999996 26.3 26.224999999999998 27 20.225 26.200000000000003 26.025 27.55 28 21.9 25.974999999999998 26.75 25.374999999999996 29 22.45 25.074999999999996 25.674999999999997 26.8 30 21.224999999999998 25.174999999999997 26.825 26.775 31 22.175 25.624999999999996 26.35 25.85 32 21.975 24.45 27.700000000000003 25.874999999999996 33 22.6 23.925 27.375 26.1 34 22.125 25.25 27.025 25.6 35 22.95 24.9 26.150000000000002 26.0 36 21.224999999999998 24.675 26.200000000000003 27.900000000000002 37 21.7 26.450000000000003 25.1 26.75 38 22.0 24.425 27.3 26.275 39 21.95 24.85 26.0 27.200000000000003 40 21.95 25.75 25.55 26.75 41 22.0 25.124999999999996 26.575 26.3 42 22.325 23.65 26.224999999999998 27.800000000000004 43 22.6 25.374999999999996 25.45 26.575 44 23.125 22.925 27.500000000000004 26.450000000000003 45 23.150000000000002 24.375 24.975 27.500000000000004 46 21.275 24.0 26.674999999999997 28.050000000000004 47 21.625 25.1 26.974999999999998 26.3 48 21.875 24.525 25.85 27.750000000000004 49 22.1 25.575 26.525 25.8 50 21.45 26.275 26.35 25.924999999999997 51 22.025 24.15 26.35 27.474999999999998 52 23.3 24.625 25.324999999999996 26.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 4.0 19 8.0 20 4.5 21 1.0 22 3.5 23 6.0 24 6.5 25 7.0 26 12.0 27 17.0 28 19.0 29 21.0 30 28.0 31 35.0 32 49.0 33 63.0 34 70.5 35 78.0 36 97.0 37 116.0 38 128.0 39 167.5 40 195.0 41 216.5 42 238.0 43 285.0 44 332.0 45 348.5 46 365.0 47 378.5 48 392.0 49 388.5 50 385.0 51 385.0 52 385.0 53 369.5 54 354.0 55 314.0 56 274.0 57 224.0 58 174.0 59 163.0 60 152.0 61 126.0 62 100.0 63 76.0 64 46.5 65 41.0 66 30.0 67 19.0 68 19.5 69 20.0 70 16.0 71 12.0 72 9.0 73 6.0 74 5.0 75 4.0 76 3.5 77 3.0 78 2.0 79 1.0 80 1.0 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1166077738516 98.175 2 0.8076728924785461 1.6 3 0.0757193336698637 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra Read 200000 spots for SRR5423457.sra Written 200000 spots for SRR5423457.sra SRR ids: ['SRR5423457.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3bs6vj3e SRR5423457.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423457 file size 703972 SRR5423457 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423457 SRR5423457_1.fastq Input file: SRR5423457_1.fastq trimmed: SRR5423457-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 09:52:53 2025 >> started Thu Feb 13 09:59:27 2025 >> done (393.272s) 4000000 reads processed; of these: 251 ( 0.01%) short reads filtered out after trimming by size control 186 ( 0.00%) empty reads filtered out after trimming by size control 3999563 (99.99%) reads available; of these: 57370 ( 1.43%) trimmed reads available after processing 3942193 (98.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 10 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 3 0.00% 27 4 0.00% 28 7 0.00% 29 8 0.00% 30 5 0.00% 31 10 0.00% 32 22 0.00% 33 21 0.00% 34 17 0.00% 35 13 0.00% 36 19 0.00% 37 21 0.00% 38 32 0.00% 39 33 0.00% 40 55 0.00% 41 53 0.00% 42 93 0.00% 43 105 0.00% 44 161 0.00% 45 216 0.01% 46 325 0.01% 47 493 0.01% 48 898 0.02% 49 1952 0.05% 50 5994 0.15% 51 46777 1.17% 52 3942193 98.57% 3999563 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=28 prefix-density=0.20 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=166.02 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=21.3 sequence=CTTCTTCTTCTC Started job on | Feb 13 10:08:36 Started mapping on | Feb 13 10:08:58 Finished on | Feb 13 10:47:26 Mapping speed, Million of reads per hour | 6.24 Number of input reads | 3999563 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3573630 Uniquely mapped reads % | 89.35% Average mapped length | 51.85 Number of splices: Total | 458932 Number of splices: Annotated (sjdb) | 453600 Number of splices: GT/AG | 450185 Number of splices: GC/AG | 7865 Number of splices: AT/AC | 392 Number of splices: Non-canonical | 490 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328527 % of reads mapped to multiple loci | 8.21% Number of reads mapped to too many loci | 82540 % of reads mapped to too many loci | 2.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 97406 97406 97406 N_multimapping 328527 328527 328527 N_noFeature 110710 3540518 123987 N_ambiguous 32520 59 12652 UnstrandedReadsAssigned:3430400 PositiveStrandReadsAssigned:33053 NegativeStrandReadsAssigned:3436991 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423457 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423457-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,563 reads, 3,687,962 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 985 rounds 52401 SRR5423457.ke.tsv 34699 SRR5423457.se.tsv 87100 total ==> SRR5423457.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 96 15.3223 Potri.005G024800.1.v4.1 1035 936 3.00191 0.98231 Potri.004G059700.1.v4.1 961 862 11 3.90852 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 60.1713 6.48018 Potri.016G087400.1.v4.1 270 171 205 367.185 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.182967 Potri.012G127500.1.v4.1 977 878 169 58.9548 ==> SRR5423457.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 68 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423457 completed mapping pipeline successfully