Starting /dee2/code/volunteer_pipeline.sh SRR5423458 current disk space = 3092711477248 free memory = 1560941736 SRR5423458 SRAfilesize 8daff7fabaecf926e3a97ae20a03f089 SRR5423458.sra SRR5423458.sra file validated SRR5423458 is single end SRR5423458 is conventional basespace SRR5423458 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423458_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7985 34.0 31.0 34.0 31.0 34.0 2 32.9115 34.0 31.0 34.0 31.0 34.0 3 32.94325 34.0 33.0 34.0 31.0 34.0 4 36.2545 37.0 37.0 37.0 35.0 37.0 5 36.242 37.0 37.0 37.0 35.0 37.0 6 36.22275 37.0 37.0 37.0 35.0 37.0 7 36.157 37.0 37.0 37.0 35.0 37.0 8 36.289 37.0 37.0 37.0 35.0 37.0 9 38.002 39.0 39.0 39.0 35.0 39.0 10 38.04025 39.0 38.0 39.0 35.0 39.0 11 38.02425 39.0 38.0 39.0 35.0 39.0 12 37.98575 39.0 38.0 39.0 35.0 39.0 13 38.03775 39.0 38.0 39.0 35.0 39.0 14 39.54125 41.0 40.0 41.0 37.0 41.0 15 39.5935 41.0 40.0 41.0 37.0 41.0 16 39.48125 41.0 39.0 41.0 37.0 41.0 17 39.391 41.0 39.0 41.0 36.0 41.0 18 39.4565 41.0 39.0 41.0 36.0 41.0 19 39.42675 41.0 39.0 41.0 36.0 41.0 20 39.458 41.0 39.0 41.0 37.0 41.0 21 39.40775 41.0 39.0 41.0 36.0 41.0 22 39.37025 41.0 39.0 41.0 37.0 41.0 23 39.4195 41.0 39.0 41.0 37.0 41.0 24 39.41475 41.0 39.0 41.0 37.0 41.0 25 39.50625 41.0 39.0 41.0 37.0 41.0 26 39.39275 41.0 39.0 41.0 37.0 41.0 27 39.39525 41.0 39.0 41.0 37.0 41.0 28 39.355 41.0 39.0 41.0 37.0 41.0 29 39.16925 41.0 39.0 41.0 36.0 41.0 30 39.16475 41.0 39.0 41.0 36.0 41.0 31 39.173 41.0 39.0 41.0 36.0 41.0 32 39.054 40.0 39.0 41.0 36.0 41.0 33 38.9985 40.0 39.0 41.0 35.0 41.0 34 39.03125 41.0 39.0 41.0 36.0 41.0 35 38.96925 40.0 39.0 41.0 35.0 41.0 36 38.898 40.0 38.0 41.0 35.0 41.0 37 38.90725 40.0 39.0 41.0 35.0 41.0 38 38.877 40.0 38.0 41.0 35.0 41.0 39 38.74625 40.0 38.0 41.0 35.0 41.0 40 38.653 40.0 38.0 41.0 35.0 41.0 41 38.59975 40.0 38.0 41.0 35.0 41.0 42 38.5365 40.0 38.0 41.0 34.0 41.0 43 38.63825 40.0 38.0 41.0 34.0 41.0 44 38.568 40.0 38.0 41.0 34.0 41.0 45 38.31475 40.0 38.0 41.0 33.0 41.0 46 38.36175 40.0 38.0 41.0 34.0 41.0 47 38.308 40.0 38.0 41.0 34.0 41.0 48 38.182 40.0 38.0 41.0 33.0 41.0 49 38.2655 40.0 38.0 41.0 34.0 41.0 50 38.03025 40.0 38.0 41.0 33.0 41.0 51 37.8585 40.0 37.0 41.0 33.0 41.0 52 36.8525 39.0 35.0 41.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2104 1 0.0 2104 2 0.0 2104 3 0.0 2104 4 0.0 2104 5 0.0 2104 6 0.0 2104 7 0.0 2104 8 0.0 2104 9 0.0 2104 10 0.0 2104 11 0.0 2104 12 0.0 2104 13 0.0 2104 14 0.0 2104 15 0.0 2104 16 0.0 2104 17 0.0 2104 18 0.0 2104 19 0.0 2104 20 0.0 2104 21 0.0 2104 22 0.0 2104 23 0.0 2104 24 0.0 2104 25 0.0 2104 26 0.0 2104 27 0.0 2104 28 0.0 2104 29 0.0 2104 30 0.0 2104 31 0.0 2104 32 0.0 2104 33 0.0 2104 34 0.0 2104 35 0.0 2104 36 0.0 2104 37 0.0 2104 38 0.0 2104 39 0.0 2104 40 0.0 2104 41 0.0 2104 42 0.0 2104 43 0.0 2104 44 0.0 2104 45 0.0 2104 46 0.0 2104 47 0.0 2104 48 0.0 2104 49 0.0 2104 50 0.0 2104 51 0.0 2104 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 2.0 22 1.0 23 3.0 24 3.0 25 6.0 26 12.0 27 16.0 28 21.0 29 27.0 30 26.0 31 30.0 32 40.0 33 70.0 34 105.0 35 146.0 36 190.0 37 351.0 38 653.0 39 2258.0 40 36.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.17258629314657 14.457228614307155 5.152576288144072 35.217608804402204 2 22.775000000000002 15.275 35.875 26.075 3 18.625 20.9 26.525 33.95 4 23.7 29.849999999999998 22.925 23.525 5 23.525 32.525 23.200000000000003 20.75 6 19.6 32.625 24.025 23.75 7 15.4 21.85 42.6 20.150000000000002 8 17.5 20.875 30.775000000000002 30.85 9 17.474999999999998 20.9 31.65 29.975 10 19.8 35.85 23.35 21.0 11 24.85 24.75 21.175 29.225 12 21.05 22.95 27.0 28.999999999999996 13 21.9 26.025 27.474999999999998 24.6 14 21.4 24.25 27.925 26.424999999999997 15 21.325 26.275 26.200000000000003 26.200000000000003 16 22.275 26.6 26.55 24.575 17 21.9 24.6 27.05 26.450000000000003 18 21.15 25.224999999999998 27.075 26.55 19 21.925 25.674999999999997 26.85 25.55 20 23.0 24.85 25.900000000000002 26.25 21 21.9 24.85 27.200000000000003 26.05 22 22.675 27.150000000000002 25.124999999999996 25.05 23 21.95 24.85 26.025 27.175 24 20.8 26.025 26.424999999999997 26.75 25 22.075 24.775 26.400000000000002 26.75 26 21.349999999999998 25.924999999999997 25.85 26.875 27 21.7 26.25 25.974999999999998 26.075 28 23.200000000000003 25.224999999999998 25.074999999999996 26.5 29 22.900000000000002 24.474999999999998 25.8 26.825 30 22.2 24.3 26.05 27.450000000000003 31 22.2 26.924999999999997 25.124999999999996 25.75 32 21.75 25.6 27.0 25.650000000000002 33 21.15 24.05 27.474999999999998 27.325 34 22.875 25.15 26.775 25.2 35 22.075 23.9 26.5 27.525 36 22.525000000000002 23.65 25.924999999999997 27.900000000000002 37 22.475 25.674999999999997 25.575 26.275 38 22.725 24.65 27.224999999999998 25.4 39 22.15 24.75 25.224999999999998 27.875 40 22.1 24.474999999999998 26.924999999999997 26.5 41 21.875 24.85 25.6 27.675 42 21.875 25.5 25.900000000000002 26.724999999999998 43 23.25 25.674999999999997 25.05 26.025 44 22.075 23.35 28.175 26.400000000000002 45 20.75 25.0 26.8 27.450000000000003 46 21.9 24.65 26.724999999999998 26.724999999999998 47 21.62162162162162 24.724724724724727 26.851851851851855 26.8018018018018 48 21.546546546546548 23.8988988988989 26.55155155155155 28.003003003003002 49 23.705926481620406 25.081270317579396 25.18129532383096 26.03150787696924 50 22.155538884721178 25.35633908477119 25.93148287071768 26.556639159789945 51 21.405351337834457 24.50612653163291 25.256314078519633 28.832208052013 52 22.55 25.5 25.3 26.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 2.0 18 2.0 19 2.0 20 3.0 21 4.0 22 4.5 23 5.0 24 4.5 25 4.0 26 9.5 27 15.0 28 19.0 29 23.0 30 24.0 31 25.0 32 45.0 33 65.0 34 68.0 35 71.0 36 84.5 37 98.0 38 115.0 39 182.5 40 233.0 41 249.5 42 266.0 43 299.0 44 332.0 45 335.5 46 339.0 47 371.0 48 403.0 49 393.0 50 383.0 51 397.0 52 411.0 53 369.5 54 328.0 55 292.0 56 256.0 57 226.5 58 197.0 59 167.5 60 138.0 61 122.0 62 106.0 63 81.5 64 46.5 65 36.0 66 31.5 67 27.0 68 22.0 69 17.0 70 12.0 71 7.0 72 5.0 73 3.0 74 7.5 75 12.0 76 6.5 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.1 48 0.1 49 0.025 50 0.025 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8621997471555 97.75 2 1.1378002528445006 2.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra Read 200000 spots for SRR5423458.sra Written 200000 spots for SRR5423458.sra SRR ids: ['SRR5423458.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uhs0ph8d SRR5423458.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423458 file size 703960 SRR5423458 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423458 SRR5423458_1.fastq Input file: SRR5423458_1.fastq trimmed: SRR5423458-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 09:52:15 2025 >> started Thu Feb 13 09:58:23 2025 >> done (367.297s) 4000000 reads processed; of these: 239 ( 0.01%) short reads filtered out after trimming by size control 191 ( 0.00%) empty reads filtered out after trimming by size control 3999570 (99.99%) reads available; of these: 52493 ( 1.31%) trimmed reads available after processing 3947077 (98.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 8 0.00% 20 5 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 2 0.00% 30 4 0.00% 31 8 0.00% 32 9 0.00% 33 20 0.00% 34 20 0.00% 35 13 0.00% 36 16 0.00% 37 23 0.00% 38 28 0.00% 39 33 0.00% 40 56 0.00% 41 65 0.00% 42 83 0.00% 43 121 0.00% 44 172 0.00% 45 228 0.01% 46 376 0.01% 47 486 0.01% 48 904 0.02% 49 1909 0.05% 50 5850 0.15% 51 42035 1.05% 52 3947077 98.69% 3999570 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=28 prefix-density=0.20 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=76.60 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.5 sequence=ACAGCAGCACTCGATGTATCCACAAATGTGGCATTGAATCTATTGGCAAGGAATTCGCCATATGCTGCATTCTTAAGGTATATATCGGCAGAGGAGCCCCTTCCTCCGAAGACGATTTCCGGCGTGTTCTCTAAGCAATTCGTCTCGGTTATCTCATTTACACACTCTTGCAACTTCAAACCCTGCAGCTCAGAGGCAACCGCAAGCCAGTTTGAATCGACGGGAAGCCACAACAGGTTCTGTGATGGGTTCCCGGAAGTATACAGTTTTACTTTCTGAAAATCTGCGCTTCCCAAGGAATTGACTCCTTTCTGTGGAAGATTGAAGTCTCCGAATTTGAGTTTCCCTCTCGTTGACGCGTTGCTCTTCCATTCCCAATTTCCTGTGAAGGCAACAGACTCTGGCACAGCAACATCACCAAGACGCAACGAATCGCTGACACTTCCAGCACTCCCAAAATGAATGATTCCTCGGA Started job on | Feb 13 10:06:25 Started mapping on | Feb 13 10:06:44 Finished on | Feb 13 10:41:00 Mapping speed, Million of reads per hour | 7.00 Number of input reads | 3999570 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3573923 Uniquely mapped reads % | 89.36% Average mapped length | 51.85 Number of splices: Total | 457065 Number of splices: Annotated (sjdb) | 451746 Number of splices: GT/AG | 448538 Number of splices: GC/AG | 7697 Number of splices: AT/AC | 346 Number of splices: Non-canonical | 484 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328279 % of reads mapped to multiple loci | 8.21% Number of reads mapped to too many loci | 82420 % of reads mapped to too many loci | 2.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 97368 97368 97368 N_multimapping 328279 328279 328279 N_noFeature 110600 3541260 123872 N_ambiguous 31935 38 12523 UnstrandedReadsAssigned:3431388 PositiveStrandReadsAssigned:32625 NegativeStrandReadsAssigned:3437528 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423458 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423458-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,570 reads, 3,677,734 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR5423458.ke.tsv 34699 SRR5423458.se.tsv 87100 total ==> SRR5423458.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 79 12.6413 Potri.005G024800.1.v4.1 1035 936 4.00479 1.31384 Potri.004G059700.1.v4.1 961 862 7 2.49362 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 55.1875 5.95868 Potri.016G087400.1.v4.1 270 171 175.843 315.768 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 4 0.733742 Potri.012G127500.1.v4.1 977 878 174 60.8546 ==> SRR5423458.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 83 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423458 completed mapping pipeline successfully