Starting /dee2/code/volunteer_pipeline.sh SRR5423459 current disk space = 3051750379520 free memory = 1582330236 SRR5423459 SRAfilesize be51ee0e0ef64dc558dac57ad5e6f3c4 SRR5423459.sra SRR5423459.sra file validated SRR5423459 is single end SRR5423459 is conventional basespace SRR5423459 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.07825 31.0 31.0 34.0 28.0 34.0 2 31.51425 31.0 31.0 34.0 30.0 34.0 3 31.769 31.0 31.0 34.0 30.0 34.0 4 30.919 35.0 28.0 37.0 16.0 37.0 5 33.94475 35.0 33.0 37.0 28.0 37.0 6 34.9095 35.0 35.0 37.0 32.0 37.0 7 35.265 37.0 35.0 37.0 33.0 37.0 8 35.4585 37.0 35.0 37.0 33.0 37.0 9 37.17075 39.0 37.0 39.0 33.0 39.0 10 37.1005 39.0 37.0 39.0 33.0 39.0 11 36.9045 39.0 37.0 39.0 33.0 39.0 12 37.06325 39.0 37.0 39.0 33.0 39.0 13 36.8545 39.0 37.0 39.0 32.0 39.0 14 38.301 40.0 38.0 41.0 33.0 41.0 15 38.37575 40.0 38.0 41.0 34.0 41.0 16 38.35675 40.0 38.0 41.0 33.0 41.0 17 38.262 40.0 38.0 41.0 33.0 41.0 18 38.15775 40.0 37.0 41.0 33.0 41.0 19 38.244 40.0 37.0 41.0 34.0 41.0 20 38.301 40.0 38.0 41.0 34.0 41.0 21 38.39525 40.0 38.0 41.0 34.0 41.0 22 38.293 40.0 38.0 41.0 33.0 41.0 23 38.148 40.0 37.0 41.0 33.0 41.0 24 38.22125 40.0 38.0 41.0 34.0 41.0 25 38.0865 40.0 37.0 41.0 33.0 41.0 26 38.1135 40.0 37.0 41.0 33.0 41.0 27 38.099 40.0 37.0 41.0 33.0 41.0 28 38.05525 40.0 37.0 41.0 33.0 41.0 29 37.82325 40.0 37.0 41.0 32.0 41.0 30 37.85975 40.0 37.0 41.0 33.0 41.0 31 37.90325 40.0 37.0 41.0 33.0 41.0 32 37.8665 40.0 37.0 41.0 33.0 41.0 33 25.7545 30.0 9.0 40.0 8.0 41.0 34 29.8125 33.0 17.0 40.0 16.0 41.0 35 34.23325 35.0 30.0 40.0 25.0 41.0 36 36.017 38.0 35.0 40.0 30.0 41.0 37 36.805 39.0 36.0 40.0 30.0 41.0 38 37.24675 39.0 36.0 40.0 31.0 41.0 39 37.53125 39.0 37.0 41.0 32.0 41.0 40 37.42975 40.0 37.0 41.0 31.0 41.0 41 37.41475 40.0 36.0 41.0 32.0 41.0 42 37.29925 39.0 36.0 41.0 31.0 41.0 43 37.19675 39.0 36.0 41.0 31.0 41.0 44 37.2965 39.0 36.0 41.0 31.0 41.0 45 37.164 39.0 36.0 41.0 31.0 41.0 46 37.212 39.0 36.0 41.0 31.0 41.0 47 37.00225 39.0 36.0 41.0 31.0 41.0 48 36.9015 39.0 35.0 41.0 31.0 41.0 49 36.91 39.0 35.0 41.0 30.0 41.0 50 37.05075 39.0 36.0 41.0 31.0 41.0 51 36.757 39.0 35.0 41.0 30.0 41.0 52 36.428 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2116 1 0.0 2116 2 0.0 2116 3 0.0 2116 4 0.0 2116 5 0.0 2116 6 0.0 2116 7 0.0 2116 8 0.0 2116 9 0.0 2116 10 0.0 2116 11 0.0 2116 12 0.0 2116 13 0.0 2116 14 0.0 2116 15 0.0 2116 16 0.0 2116 17 0.0 2116 18 0.0 2116 19 0.0 2116 20 0.0 2116 21 0.0 2116 22 0.0 2116 23 0.0 2116 24 0.0 2116 25 0.0 2116 26 0.0 2116 27 0.0 2116 28 0.0 2116 29 0.0 2116 30 0.0 2116 31 0.0 2116 32 0.0 2116 33 0.0 2116 34 0.0 2116 35 0.0 2116 36 0.0 2116 37 0.0 2116 38 0.0 2116 39 0.0 2116 40 0.0 2116 41 0.0 2116 42 0.0 2116 43 0.0 2116 44 0.0 2116 45 0.0 2116 46 0.0 2116 47 0.0 2116 48 0.0 2116 49 0.0 2116 50 0.0 2116 51 0.0 2116 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 1.0 22 5.0 23 4.0 24 8.0 25 17.0 26 24.0 27 26.0 28 39.0 29 54.0 30 94.0 31 121.0 32 149.0 33 205.0 34 249.0 35 312.0 36 419.0 37 678.0 38 896.0 39 695.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.757196495619525 13.81727158948686 5.782227784730914 34.643304130162704 2 22.925 15.174999999999999 36.325 25.575 3 18.025 21.85 28.075 32.05 4 24.7 26.650000000000002 26.924999999999997 21.725 5 23.275000000000002 33.6 23.3 19.825 6 19.15 32.6 25.0 23.25 7 16.025 20.75 42.95 20.275000000000002 8 17.075000000000003 21.375 30.725 30.825000000000003 9 18.525 20.674999999999997 32.925 27.875 10 21.125 34.475 24.325 20.075000000000003 11 24.55 24.275 23.25 27.925 12 22.175 22.15 25.55 30.125 13 19.2 26.3 29.175 25.324999999999996 14 19.6 26.924999999999997 26.525 26.950000000000003 15 20.9 26.875 25.7 26.525 16 21.9 25.825 25.95 26.325 17 22.05 24.775 28.299999999999997 24.875 18 21.425 24.275 27.3 27.0 19 21.425 26.825 25.95 25.8 20 20.775 24.45 27.35 27.425 21 21.65 24.875 26.974999999999998 26.5 22 23.0 26.1 25.55 25.35 23 20.974999999999998 25.900000000000002 27.025 26.1 24 21.475 25.374999999999996 27.0 26.150000000000002 25 22.5 25.224999999999998 25.85 26.424999999999997 26 21.275 25.75 26.424999999999997 26.55 27 20.175 25.650000000000002 27.075 27.1 28 20.65 26.3 26.75 26.3 29 22.125 24.85 26.325 26.700000000000003 30 21.6 23.1 27.1 28.199999999999996 31 21.575 25.724999999999998 27.05 25.650000000000002 32 23.200000000000003 25.025 25.4 26.375 33 35.4 24.525 20.925 19.15 34 22.45 25.224999999999998 26.474999999999998 25.85 35 22.275 24.125 27.224999999999998 26.375 36 21.9 22.425 26.625 29.049999999999997 37 21.525 25.374999999999996 26.150000000000002 26.950000000000003 38 22.0 25.8 26.0 26.200000000000003 39 22.275 23.425 26.650000000000002 27.650000000000002 40 22.3 25.224999999999998 25.0 27.474999999999998 41 21.075 25.45 26.325 27.150000000000002 42 21.525 23.849999999999998 27.35 27.275 43 21.525 25.95 26.35 26.174999999999997 44 22.15 24.5 26.6 26.75 45 20.9 25.35 26.75 27.0 46 22.5 25.624999999999996 25.775 26.1 47 22.71703777833375 23.817863397548162 27.020265198899175 26.444833625218916 48 23.067300475356518 23.892919689767325 26.344758568926697 26.695021265949464 49 23.549999999999997 24.525 26.674999999999997 25.25 50 22.491868901676256 24.06805103827871 25.769326995246434 27.670753064798596 51 20.880220055013755 24.60615153788447 26.456614153538382 28.057014253563388 52 22.45 26.775 25.374999999999996 25.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 4.0 20 3.0 21 2.0 22 5.5 23 9.0 24 10.5 25 12.0 26 12.5 27 13.0 28 17.5 29 22.0 30 31.0 31 40.0 32 49.5 33 59.0 34 66.5 35 74.0 36 103.5 37 133.0 38 148.5 39 183.0 40 202.0 41 217.0 42 232.0 43 269.0 44 306.0 45 330.5 46 355.0 47 389.0 48 423.0 49 397.0 50 371.0 51 374.5 52 378.0 53 366.0 54 354.0 55 301.0 56 248.0 57 228.5 58 209.0 59 178.5 60 148.0 61 123.0 62 98.0 63 73.0 64 42.0 65 36.0 66 29.0 67 22.0 68 18.0 69 14.0 70 12.5 71 11.0 72 9.0 73 7.0 74 6.0 75 5.0 76 3.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.075 48 0.075 49 0.0 50 0.075 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra Read 200000 spots for SRR5423459.sra Written 200000 spots for SRR5423459.sra SRR ids: ['SRR5423459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lamu79yc SRR5423459.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423459 file size 703957 SRR5423459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423459 SRR5423459_1.fastq Input file: SRR5423459_1.fastq trimmed: SRR5423459-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:12:18 2025 >> started Wed Feb 12 15:12:20 2025 >> done (1.878s) 4000000 reads processed; of these: 247 ( 0.01%) short reads filtered out after trimming by size control 200 ( 0.01%) empty reads filtered out after trimming by size control 3999553 (99.99%) reads available; of these: 61301 ( 1.53%) trimmed reads available after processing 3938252 (98.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 8 0.00% 20 9 0.00% 21 0 0.00% 22 0 0.00% 23 3 0.00% 24 1 0.00% 25 11 0.00% 26 7 0.00% 27 6 0.00% 28 8 0.00% 29 10 0.00% 30 11 0.00% 31 15 0.00% 32 32 0.00% 33 30 0.00% 34 24 0.00% 35 34 0.00% 36 31 0.00% 37 57 0.00% 38 56 0.00% 39 61 0.00% 40 100 0.00% 41 137 0.00% 42 117 0.00% 43 150 0.00% 44 213 0.01% 45 371 0.01% 46 595 0.01% 47 767 0.02% 48 1336 0.03% 49 2563 0.06% 50 7035 0.18% 51 47490 1.19% 52 3938252 98.47% 3999553 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=30 prefix-density=0.20 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=168.14 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=21.6 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:12:37 Started mapping on | Feb 12 15:12:37 Finished on | Feb 12 15:12:42 Mapping speed, Million of reads per hour | 2879.68 Number of input reads | 3999553 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3572118 Uniquely mapped reads % | 89.31% Average mapped length | 51.84 Number of splices: Total | 458078 Number of splices: Annotated (sjdb) | 452619 Number of splices: GT/AG | 449380 Number of splices: GC/AG | 7853 Number of splices: AT/AC | 350 Number of splices: Non-canonical | 495 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330191 % of reads mapped to multiple loci | 8.26% Number of reads mapped to too many loci | 81121 % of reads mapped to too many loci | 2.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 97244 97244 97244 N_multimapping 330191 330191 330191 N_noFeature 110773 3539402 124041 N_ambiguous 31768 60 12277 UnstrandedReadsAssigned:3429577 PositiveStrandReadsAssigned:32656 NegativeStrandReadsAssigned:3435800 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423459 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423459-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,553 reads, 3,689,111 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR5423459.ke.tsv 34699 SRR5423459.se.tsv 87100 total ==> SRR5423459.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 75 11.9632 Potri.005G024800.1.v4.1 1035 936 6 1.96218 Potri.004G059700.1.v4.1 961 862 12 4.26125 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 44.1307 4.74978 Potri.016G087400.1.v4.1 270 171 168 300.729 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 3 0.548566 Potri.012G127500.1.v4.1 977 878 178 62.0566 ==> SRR5423459.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 86 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423459 completed mapping pipeline successfully