Starting /dee2/code/volunteer_pipeline.sh SRR5423460 current disk space = 3051729403904 free memory = 1574548216 SRR5423460 SRAfilesize 5a532a6803e89f6441910395824a6bc3 SRR5423460.sra SRR5423460.sra file validated SRR5423460 is single end SRR5423460 is conventional basespace SRR5423460 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6665 31.0 31.0 34.0 30.0 34.0 2 31.96425 33.0 31.0 34.0 30.0 34.0 3 32.1475 34.0 31.0 34.0 30.0 34.0 4 33.2575 37.0 33.0 37.0 25.0 37.0 5 34.93875 37.0 35.0 37.0 32.0 37.0 6 35.45475 37.0 35.0 37.0 33.0 37.0 7 35.667 37.0 35.0 37.0 33.0 37.0 8 35.77125 37.0 35.0 37.0 33.0 37.0 9 37.60825 39.0 37.0 39.0 35.0 39.0 10 37.33425 39.0 37.0 39.0 34.0 39.0 11 37.36375 39.0 37.0 39.0 34.0 39.0 12 37.3235 39.0 37.0 39.0 34.0 39.0 13 37.456 39.0 37.0 39.0 35.0 39.0 14 38.74575 40.0 38.0 41.0 34.0 41.0 15 38.83 40.0 38.0 41.0 35.0 41.0 16 38.707 40.0 38.0 41.0 34.0 41.0 17 38.67325 40.0 38.0 41.0 34.0 41.0 18 38.617 40.0 38.0 41.0 34.0 41.0 19 38.75175 40.0 38.0 41.0 34.0 41.0 20 38.7525 40.0 38.0 41.0 35.0 41.0 21 38.71575 40.0 38.0 41.0 34.0 41.0 22 38.50975 40.0 38.0 41.0 34.0 41.0 23 38.73175 40.0 38.0 41.0 35.0 41.0 24 38.7625 40.0 38.0 41.0 34.0 41.0 25 38.66875 40.0 38.0 41.0 34.0 41.0 26 38.5385 40.0 38.0 41.0 34.0 41.0 27 38.5675 40.0 38.0 41.0 34.0 41.0 28 38.49275 40.0 38.0 41.0 34.0 41.0 29 38.6065 40.0 38.0 41.0 34.0 41.0 30 38.54875 40.0 38.0 41.0 34.0 41.0 31 38.53175 40.0 38.0 41.0 34.0 41.0 32 38.41425 40.0 38.0 41.0 34.0 41.0 33 38.36425 40.0 38.0 41.0 34.0 41.0 34 38.302 40.0 38.0 41.0 34.0 41.0 35 38.25225 40.0 38.0 41.0 33.0 41.0 36 38.24925 40.0 38.0 41.0 34.0 41.0 37 38.26525 40.0 38.0 41.0 34.0 41.0 38 38.21625 40.0 38.0 41.0 34.0 41.0 39 38.183 40.0 38.0 41.0 33.0 41.0 40 37.96 40.0 38.0 41.0 33.0 41.0 41 38.0245 40.0 37.0 41.0 33.0 41.0 42 38.0225 40.0 37.0 41.0 33.0 41.0 43 37.826 40.0 37.0 41.0 33.0 41.0 44 37.881 40.0 37.0 41.0 33.0 41.0 45 37.78075 40.0 37.0 41.0 33.0 41.0 46 37.598 40.0 37.0 41.0 32.0 41.0 47 37.48675 40.0 36.0 41.0 31.0 41.0 48 37.50575 40.0 37.0 41.0 32.0 41.0 49 37.50325 40.0 36.0 41.0 32.0 41.0 50 37.34525 39.0 36.0 41.0 32.0 41.0 51 37.346 39.0 36.0 41.0 32.0 41.0 52 36.87875 39.0 35.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2213 1 0.0 2213 2 0.0 2213 3 0.0 2213 4 0.0 2213 5 0.0 2213 6 0.0 2213 7 0.0 2213 8 0.0 2213 9 0.0 2213 10 0.0 2213 11 0.0 2213 12 0.0 2213 13 0.0 2213 14 0.0 2213 15 0.0 2213 16 0.0 2213 17 0.0 2213 18 0.0 2213 19 0.0 2213 20 0.0 2213 21 0.0 2213 22 0.0 2213 23 0.0 2213 24 0.0 2213 25 0.0 2213 26 0.0 2213 27 0.0 2213 28 0.0 2213 29 0.0 2213 30 0.0 2213 31 0.0 2213 32 0.0 2213 33 0.0 2213 34 0.0 2213 35 0.0 2213 36 0.0 2213 37 0.0 2213 38 0.0 2213 39 0.0 2213 40 0.0 2213 41 0.0 2213 42 0.0 2213 43 0.0 2213 44 0.0 2213 45 0.0 2213 46 0.0 2213 47 0.0 2213 48 0.0 2213 49 0.0 2213 50 0.0 2213 51 0.0 2213 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 4.0 23 5.0 24 2.0 25 11.0 26 11.0 27 13.0 28 24.0 29 38.0 30 46.0 31 73.0 32 105.0 33 110.0 34 164.0 35 236.0 36 302.0 37 472.0 38 785.0 39 1590.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.92092092092092 14.18918918918919 5.155155155155155 34.73473473473474 2 22.45 15.25 35.975 26.325 3 18.4 21.5 26.875 33.225 4 23.599999999999998 28.125 25.8 22.475 5 22.35 32.300000000000004 24.3 21.05 6 20.0 31.474999999999998 24.975 23.549999999999997 7 15.425 21.55 42.95 20.075000000000003 8 17.299999999999997 21.325 30.775000000000002 30.599999999999998 9 19.05 20.05 32.4 28.499999999999996 10 20.65 35.875 23.7 19.775000000000002 11 24.725 24.55 21.725 28.999999999999996 12 21.575 21.85 26.0 30.575000000000003 13 20.95 25.424999999999997 28.849999999999998 24.775 14 19.575 25.650000000000002 28.449999999999996 26.325 15 20.45 25.525 26.55 27.474999999999998 16 21.575 26.575 26.924999999999997 24.925 17 21.55 24.3 27.525 26.625 18 20.325 25.624999999999996 26.224999999999998 27.825 19 21.075 26.700000000000003 26.8 25.424999999999997 20 22.075 25.474999999999998 26.275 26.174999999999997 21 21.075 24.075 27.35 27.500000000000004 22 21.575 27.025 25.924999999999997 25.474999999999998 23 21.625 25.924999999999997 26.375 26.075 24 21.65 23.799999999999997 26.625 27.925 25 20.4 26.450000000000003 26.724999999999998 26.424999999999997 26 20.875 25.15 27.925 26.05 27 20.9 24.025 26.674999999999997 28.4 28 21.775 25.05 26.5 26.674999999999997 29 22.8 24.625 26.375 26.200000000000003 30 20.3 24.65 27.325 27.725 31 22.375 25.124999999999996 26.450000000000003 26.05 32 21.85 25.974999999999998 26.525 25.650000000000002 33 22.5 24.025 26.6 26.875 34 22.0 24.825 26.325 26.85 35 21.675 25.624999999999996 27.125 25.575 36 20.7 25.35 26.55 27.400000000000002 37 23.200000000000003 23.5 24.725 28.575 38 22.400000000000002 24.25 26.950000000000003 26.400000000000002 39 21.575 23.9 27.200000000000003 27.325 40 21.575 26.424999999999997 25.8 26.200000000000003 41 21.6 25.474999999999998 26.625 26.3 42 20.974999999999998 25.650000000000002 26.25 27.125 43 22.025 24.825 25.974999999999998 27.175 44 21.55 26.3 25.974999999999998 26.174999999999997 45 21.05 24.25 26.924999999999997 27.775 46 22.25 25.074999999999996 26.1 26.575 47 22.05 25.6 26.75 25.6 48 20.225 24.975 27.3 27.500000000000004 49 22.3 25.825 25.874999999999996 26.0 50 22.725 24.075 26.650000000000002 26.55 51 20.875 23.974999999999998 28.125 27.025 52 23.45 24.9 26.325 25.324999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 2.5 21 4.0 22 5.5 23 7.0 24 8.5 25 10.0 26 14.0 27 18.0 28 22.5 29 27.0 30 33.0 31 39.0 32 42.5 33 46.0 34 66.5 35 87.0 36 105.5 37 124.0 38 143.5 39 172.0 40 181.0 41 227.5 42 274.0 43 307.0 44 340.0 45 358.5 46 377.0 47 366.5 48 356.0 49 382.5 50 409.0 51 394.5 52 380.0 53 352.0 54 324.0 55 304.5 56 285.0 57 237.5 58 190.0 59 166.5 60 143.0 61 110.0 62 77.0 63 57.0 64 33.0 65 29.0 66 25.0 67 21.0 68 18.0 69 15.0 70 13.5 71 12.0 72 12.0 73 12.0 74 8.5 75 5.0 76 3.0 77 1.0 78 1.5 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14206409285894 98.225 2 0.7822356800403736 1.55 3 0.0757002271006813 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra Read 200000 spots for SRR5423460.sra Written 200000 spots for SRR5423460.sra SRR ids: ['SRR5423460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e1xgbcvi SRR5423460.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423460 file size 703979 SRR5423460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423460 SRR5423460_1.fastq Input file: SRR5423460_1.fastq trimmed: SRR5423460-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:16:12 2025 >> started Wed Feb 12 15:16:13 2025 >> done (1.261s) 4000000 reads processed; of these: 278 ( 0.01%) short reads filtered out after trimming by size control 178 ( 0.00%) empty reads filtered out after trimming by size control 3999544 (99.99%) reads available; of these: 55526 ( 1.39%) trimmed reads available after processing 3944018 (98.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 10 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 5 0.00% 25 4 0.00% 26 3 0.00% 27 2 0.00% 28 9 0.00% 29 12 0.00% 30 12 0.00% 31 7 0.00% 32 18 0.00% 33 20 0.00% 34 22 0.00% 35 22 0.00% 36 35 0.00% 37 37 0.00% 38 46 0.00% 39 37 0.00% 40 79 0.00% 41 80 0.00% 42 107 0.00% 43 135 0.00% 44 196 0.00% 45 320 0.01% 46 441 0.01% 47 672 0.02% 48 1054 0.03% 49 2183 0.05% 50 6138 0.15% 51 43795 1.09% 52 3944018 98.61% 3999544 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=28 prefix-density=0.19 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=95.04 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.9 sequence=ACAGCAGCACTCGATGTATCCACAAATGTGGCATTGAATCTATTGGCAAGGAATTCGCCATATGCTGCATTCTTAAGGTATATATCGGCAGAGGAGCCCCTTCCTCCGAAGACGATTTCCGGCGTGTTCTCTAAGCAATTCGTCTCGGTTATCTCATTTACACACTCTTGCAACTTCAAACCCTGCAGCTCAGAGGCAACCGCAAGCCAGTTTGAATCGACGGGAAGCCACAACAGGTTCTGTGATGGGTTCCCGGAAGTATACAGTTTTACTTTCTGAAAATCTGCGCTTCCCAAGGAATTGACTCCTTTCTGTGGAAGATTGAAGTCTCCGAATTTGAGTTTCCCTCTCGTTGACGCGTTGCTCTTCCATTCCCAATTTCCTGTGAAGGCAACAGACTCTGGCACAGCAACATCACCAAGACGCAACGAATCGCTGACACTTCCAGCACTCCCAAAATGAATGATTCCTCGGATGC Started job on | Feb 12 15:16:24 Started mapping on | Feb 12 15:16:24 Finished on | Feb 12 15:16:30 Mapping speed, Million of reads per hour | 2399.73 Number of input reads | 3999544 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3572460 Uniquely mapped reads % | 89.32% Average mapped length | 51.85 Number of splices: Total | 458140 Number of splices: Annotated (sjdb) | 452665 Number of splices: GT/AG | 449349 Number of splices: GC/AG | 7882 Number of splices: AT/AC | 367 Number of splices: Non-canonical | 542 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330309 % of reads mapped to multiple loci | 8.26% Number of reads mapped to too many loci | 81269 % of reads mapped to too many loci | 2.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.38% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 96775 96775 96775 N_multimapping 330309 330309 330309 N_noFeature 111136 3539528 124351 N_ambiguous 32282 57 12531 UnstrandedReadsAssigned:3429042 PositiveStrandReadsAssigned:32875 NegativeStrandReadsAssigned:3435578 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423460 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423460-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,544 reads, 3,688,298 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR5423460.ke.tsv 34699 SRR5423460.se.tsv 87100 total ==> SRR5423460.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 83 13.2459 Potri.005G024800.1.v4.1 1035 936 7 2.29035 Potri.004G059700.1.v4.1 961 862 7 2.48697 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 53.6735 5.77977 Potri.016G087400.1.v4.1 270 171 169 302.671 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 168 58.5996 ==> SRR5423460.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 74 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423460 completed mapping pipeline successfully