Starting /dee2/code/volunteer_pipeline.sh SRR5423461 current disk space = 3051768823808 free memory = 1579650384 SRR5423461 SRAfilesize 4d422ea1b65b1b358e1fc37a98c4b07d SRR5423461.sra SRR5423461.sra file validated SRR5423461 is single end SRR5423461 is conventional basespace SRR5423461 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423461_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1585 33.0 31.0 34.0 30.0 34.0 2 32.38925 34.0 31.0 34.0 30.0 34.0 3 32.4285 34.0 31.0 34.0 30.0 34.0 4 34.15825 37.0 35.0 37.0 28.0 37.0 5 35.483 37.0 35.0 37.0 33.0 37.0 6 35.512 37.0 35.0 37.0 33.0 37.0 7 35.856 37.0 35.0 37.0 35.0 37.0 8 35.932 37.0 35.0 37.0 35.0 37.0 9 37.661 39.0 37.0 39.0 35.0 39.0 10 37.62625 39.0 37.0 39.0 35.0 39.0 11 37.60025 39.0 37.0 39.0 35.0 39.0 12 37.62525 39.0 37.0 39.0 35.0 39.0 13 37.5745 39.0 37.0 39.0 35.0 39.0 14 38.89475 40.0 38.0 41.0 35.0 41.0 15 39.03125 40.0 38.0 41.0 36.0 41.0 16 38.898 40.0 38.0 41.0 35.0 41.0 17 38.9845 40.0 38.0 41.0 35.0 41.0 18 39.0965 40.0 38.0 41.0 36.0 41.0 19 39.14575 40.0 39.0 41.0 36.0 41.0 20 38.91425 40.0 39.0 41.0 35.0 41.0 21 38.90025 40.0 38.0 41.0 35.0 41.0 22 38.88325 40.0 38.0 41.0 35.0 41.0 23 38.83825 40.0 38.0 41.0 35.0 41.0 24 38.59925 40.0 38.0 41.0 34.0 41.0 25 38.90525 40.0 38.0 41.0 35.0 41.0 26 38.799 40.0 38.0 41.0 35.0 41.0 27 38.71 40.0 38.0 41.0 35.0 41.0 28 38.73875 40.0 38.0 41.0 35.0 41.0 29 38.61175 40.0 38.0 41.0 34.0 41.0 30 38.53175 40.0 38.0 41.0 34.0 41.0 31 38.68 40.0 38.0 41.0 35.0 41.0 32 38.66225 40.0 38.0 41.0 34.0 41.0 33 38.72825 40.0 38.0 41.0 35.0 41.0 34 38.694 40.0 38.0 41.0 35.0 41.0 35 38.497 40.0 38.0 41.0 34.0 41.0 36 38.59625 40.0 38.0 41.0 34.0 41.0 37 38.53125 40.0 38.0 41.0 34.0 41.0 38 38.401 40.0 38.0 41.0 34.0 41.0 39 38.40225 40.0 38.0 41.0 34.0 41.0 40 38.351 40.0 38.0 41.0 34.0 41.0 41 38.3065 40.0 38.0 41.0 34.0 41.0 42 38.06225 40.0 38.0 41.0 33.0 41.0 43 38.14725 40.0 38.0 41.0 33.0 41.0 44 38.05 40.0 37.0 41.0 33.0 41.0 45 38.07775 40.0 37.0 41.0 33.0 41.0 46 37.8395 40.0 37.0 41.0 33.0 41.0 47 37.7435 40.0 37.0 41.0 33.0 41.0 48 37.76075 40.0 37.0 41.0 32.0 41.0 49 37.51425 40.0 37.0 41.0 32.0 41.0 50 37.51775 40.0 36.0 41.0 32.0 41.0 51 37.6645 40.0 37.0 41.0 32.0 41.0 52 36.82175 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2310 1 0.0 2310 2 0.0 2310 3 0.0 2310 4 0.0 2310 5 0.0 2310 6 0.0 2310 7 0.0 2310 8 0.0 2310 9 0.0 2310 10 0.0 2310 11 0.0 2310 12 0.0 2310 13 0.0 2310 14 0.0 2310 15 0.0 2310 16 0.0 2310 17 0.0 2310 18 0.0 2310 19 0.0 2310 20 0.0 2310 21 0.0 2310 22 0.0 2310 23 0.0 2310 24 0.0 2310 25 0.0 2310 26 0.0 2310 27 0.0 2310 28 0.0 2310 29 0.0 2310 30 0.0 2310 31 0.0 2310 32 0.0 2310 33 0.0 2310 34 0.0 2310 35 0.0 2310 36 0.0 2310 37 0.0 2310 38 0.0 2310 39 0.0 2310 40 0.0 2310 41 0.0 2310 42 0.0 2310 43 0.0 2310 44 0.0 2310 45 0.0 2310 46 0.0 2310 47 0.0 2310 48 0.0 2310 49 0.0 2310 50 0.0 2310 51 0.0 2310 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.0 24 6.0 25 8.0 26 14.0 27 15.0 28 15.0 29 28.0 30 48.0 31 66.0 32 80.0 33 109.0 34 161.0 35 193.0 36 298.0 37 384.0 38 701.0 39 1863.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.458072590738425 13.016270337922403 4.58072590738423 35.94493116395495 2 21.175 17.4 34.975 26.450000000000003 3 19.15 21.175 26.8 32.875 4 24.15 28.299999999999997 24.175 23.375 5 24.05 31.85 22.55 21.55 6 19.725 32.625 23.525 24.125 7 16.8 22.35 41.699999999999996 19.15 8 18.575 21.0 29.275000000000002 31.15 9 18.375 20.599999999999998 32.05 28.975 10 20.05 35.5 23.775 20.674999999999997 11 25.25 24.975 20.125 29.65 12 22.0 22.35 26.400000000000002 29.25 13 20.275000000000002 25.724999999999998 27.400000000000002 26.6 14 20.474999999999998 25.775 27.500000000000004 26.25 15 21.725 25.35 27.0 25.924999999999997 16 22.075 24.05 27.425 26.450000000000003 17 22.1 26.05 27.175 24.675 18 21.099999999999998 24.349999999999998 27.375 27.175 19 21.375 25.424999999999997 26.25 26.950000000000003 20 21.875 24.625 27.250000000000004 26.25 21 20.65 25.15 27.425 26.775 22 21.025 26.3 27.075 25.6 23 22.675 24.3 27.125 25.900000000000002 24 21.65 24.725 26.224999999999998 27.400000000000002 25 22.900000000000002 25.525 25.85 25.724999999999998 26 21.75 24.75 27.55 25.95 27 21.425 25.1 27.375 26.1 28 22.875 24.8 25.974999999999998 26.35 29 22.525000000000002 25.5 26.0 25.974999999999998 30 21.224999999999998 25.15 25.8 27.825 31 21.0 25.424999999999997 26.150000000000002 27.425 32 20.65 24.95 27.35 27.05 33 22.7 23.474999999999998 26.974999999999998 26.85 34 23.1 25.224999999999998 26.275 25.4 35 21.825 26.375 26.200000000000003 25.6 36 21.9 24.275 26.1 27.725 37 22.45 25.874999999999996 23.825 27.85 38 21.6 25.525 27.675 25.2 39 21.275 24.975 25.374999999999996 28.375 40 21.925 26.650000000000002 25.25 26.174999999999997 41 23.75 26.025 24.825 25.4 42 22.6 24.85 25.575 26.974999999999998 43 23.175 24.4 25.55 26.875 44 21.825 25.4 26.974999999999998 25.8 45 21.65 23.275000000000002 27.224999999999998 27.85 46 22.81711283462597 25.21891418563923 25.31898924193145 26.64498373780335 47 21.916437327995997 25.31898924193145 27.445584188141105 25.31898924193145 48 21.391043282461847 24.768576432324245 26.870152614460846 26.970227670753065 49 24.131032758189548 23.95598899724931 24.656164041010253 27.25681420355089 50 22.71703777833375 24.568426319739807 25.99449587190393 26.720040030022517 51 20.775 25.0 26.974999999999998 27.250000000000004 52 22.925 24.75 25.15 27.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 1.5 19 3.0 20 2.5 21 2.0 22 4.0 23 6.0 24 8.5 25 11.0 26 14.5 27 18.0 28 24.5 29 31.0 30 31.5 31 32.0 32 41.0 33 50.0 34 67.0 35 84.0 36 94.5 37 105.0 38 123.5 39 188.5 40 235.0 41 243.0 42 251.0 43 271.5 44 292.0 45 306.0 46 320.0 47 365.5 48 411.0 49 398.5 50 386.0 51 376.5 52 367.0 53 369.0 54 371.0 55 315.0 56 259.0 57 230.0 58 201.0 59 177.0 60 153.0 61 124.0 62 95.0 63 75.0 64 44.5 65 34.0 66 32.0 67 30.0 68 25.5 69 21.0 70 16.0 71 11.0 72 13.5 73 16.0 74 9.0 75 2.0 76 2.0 77 2.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.075 47 0.075 48 0.075 49 0.025 50 0.075 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1679273827534 98.32499999999999 2 0.8068582955118508 1.6 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119541 spots for SRR5423461.sra Written 119541 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra Read 119536 spots for SRR5423461.sra Written 119536 spots for SRR5423461.sra SRR ids: ['SRR5423461.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aq_r52tc SRR5423461.sra spots: 2390725 blocks: [[1, 119536], [119537, 239072], [239073, 358608], [358609, 478144], [478145, 597680], [597681, 717216], [717217, 836752], [836753, 956288], [956289, 1075824], [1075825, 1195360], [1195361, 1314896], [1314897, 1434432], [1434433, 1553968], [1553969, 1673504], [1673505, 1793040], [1793041, 1912576], [1912577, 2032112], [2032113, 2151648], [2151649, 2271184], [2271185, 2390725]] SRR5423461 file size 420334 SRR5423461 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423461 SRR5423461_1.fastq Input file: SRR5423461_1.fastq trimmed: SRR5423461-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 14:59:51 2025 >> started Wed Feb 12 14:59:52 2025 >> done (1.172s) 2390725 reads processed; of these: 159 ( 0.01%) short reads filtered out after trimming by size control 111 ( 0.00%) empty reads filtered out after trimming by size control 2390455 (99.99%) reads available; of these: 28516 ( 1.19%) trimmed reads available after processing 2361939 (98.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 6 0.00% 20 7 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 3 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 3 0.00% 33 5 0.00% 34 6 0.00% 35 9 0.00% 36 4 0.00% 37 15 0.00% 38 7 0.00% 39 12 0.00% 40 21 0.00% 41 19 0.00% 42 34 0.00% 43 32 0.00% 44 66 0.00% 45 81 0.00% 46 148 0.01% 47 194 0.01% 48 424 0.02% 49 939 0.04% 50 3069 0.13% 51 23396 0.98% 52 2361939 98.81% 2390455 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=25 prefix-density=0.19 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=182.56 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=22.5 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:00:04 Started mapping on | Feb 12 15:00:04 Finished on | Feb 12 15:00:10 Mapping speed, Million of reads per hour | 1434.27 Number of input reads | 2390455 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2136499 Uniquely mapped reads % | 89.38% Average mapped length | 51.85 Number of splices: Total | 272960 Number of splices: Annotated (sjdb) | 269645 Number of splices: GT/AG | 267763 Number of splices: GC/AG | 4627 Number of splices: AT/AC | 203 Number of splices: Non-canonical | 367 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 195839 % of reads mapped to multiple loci | 8.19% Number of reads mapped to too many loci | 49294 % of reads mapped to too many loci | 2.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 58117 58117 58117 N_multimapping 195839 195839 195839 N_noFeature 66731 2116984 74533 N_ambiguous 19076 26 7349 UnstrandedReadsAssigned:2050692 PositiveStrandReadsAssigned:19489 NegativeStrandReadsAssigned:2054617 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423461 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423461-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,390,455 reads, 2,203,807 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR5423461.ke.tsv 34699 SRR5423461.se.tsv 87100 total ==> SRR5423461.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 47 12.5655 Potri.005G024800.1.v4.1 1035 936 1 0.548127 Potri.004G059700.1.v4.1 961 862 3 1.78554 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 38.178 6.88717 Potri.016G087400.1.v4.1 270 171 103 309.028 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 92 53.7589 ==> SRR5423461.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423461 completed mapping pipeline successfully