Starting /dee2/code/volunteer_pipeline.sh SRR5423462 current disk space = 3051797360640 free memory = 1574738628 SRR5423462 SRAfilesize afd7e304145d8e35545883b64c83b6bf SRR5423462.sra SRR5423462.sra file validated SRR5423462 is single end SRR5423462 is conventional basespace SRR5423462 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.14325 34.0 31.0 34.0 26.0 34.0 2 31.52425 34.0 31.0 34.0 26.0 34.0 3 32.506 34.0 31.0 34.0 28.0 34.0 4 36.115 37.0 35.0 37.0 35.0 37.0 5 36.10475 37.0 35.0 37.0 35.0 37.0 6 36.196 37.0 37.0 37.0 35.0 37.0 7 36.236 37.0 37.0 37.0 35.0 37.0 8 36.16875 37.0 37.0 37.0 35.0 37.0 9 37.901 39.0 38.0 39.0 35.0 39.0 10 38.05 39.0 38.0 39.0 35.0 39.0 11 38.031 39.0 38.0 39.0 35.0 39.0 12 37.9805 39.0 38.0 39.0 35.0 39.0 13 37.882 39.0 38.0 39.0 35.0 39.0 14 39.44525 41.0 39.0 41.0 36.0 41.0 15 39.36375 41.0 39.0 41.0 36.0 41.0 16 39.34625 41.0 39.0 41.0 36.0 41.0 17 39.21275 41.0 39.0 41.0 36.0 41.0 18 39.2885 41.0 39.0 41.0 36.0 41.0 19 39.36725 41.0 39.0 41.0 36.0 41.0 20 39.26375 40.0 39.0 41.0 36.0 41.0 21 39.225 41.0 39.0 41.0 36.0 41.0 22 39.3055 41.0 39.0 41.0 36.0 41.0 23 39.24325 40.0 39.0 41.0 36.0 41.0 24 39.207 40.0 39.0 41.0 36.0 41.0 25 39.2625 41.0 39.0 41.0 36.0 41.0 26 39.2615 41.0 39.0 41.0 36.0 41.0 27 39.21725 41.0 39.0 41.0 36.0 41.0 28 39.1265 40.0 39.0 41.0 36.0 41.0 29 39.108 40.0 39.0 41.0 36.0 41.0 30 39.02925 40.0 39.0 41.0 36.0 41.0 31 38.988 40.0 39.0 41.0 35.0 41.0 32 38.93475 40.0 39.0 41.0 35.0 41.0 33 38.8335 40.0 39.0 41.0 35.0 41.0 34 38.83025 40.0 38.0 41.0 35.0 41.0 35 38.75425 40.0 38.0 41.0 35.0 41.0 36 38.61725 40.0 38.0 41.0 34.0 41.0 37 38.658 40.0 38.0 41.0 35.0 41.0 38 38.5745 40.0 38.0 41.0 34.0 41.0 39 38.43525 40.0 38.0 41.0 34.0 41.0 40 38.456 40.0 38.0 41.0 34.0 41.0 41 38.33075 40.0 38.0 41.0 34.0 41.0 42 38.30975 40.0 38.0 41.0 34.0 41.0 43 38.18425 40.0 38.0 41.0 34.0 41.0 44 38.05475 40.0 38.0 41.0 33.0 41.0 45 37.81625 40.0 37.0 41.0 33.0 41.0 46 37.85125 40.0 37.0 41.0 33.0 41.0 47 37.762 40.0 37.0 41.0 32.0 41.0 48 37.8585 40.0 38.0 41.0 33.0 41.0 49 37.735 40.0 37.0 41.0 33.0 41.0 50 37.64025 40.0 37.0 41.0 32.0 41.0 51 37.5265 40.0 37.0 41.0 32.0 41.0 52 35.95225 38.0 35.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 2.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 5.0 23 3.0 24 9.0 25 7.0 26 13.0 27 12.0 28 23.0 29 14.0 30 36.0 31 48.0 32 61.0 33 75.0 34 117.0 35 179.0 36 233.0 37 383.0 38 837.0 39 1930.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.68978700163845 11.3599126160568 9.612233752048061 51.3380666302567 2 19.225 17.1 38.475 25.2 3 19.85 20.674999999999997 25.1 34.375 4 23.225 28.349999999999998 21.425 27.0 5 23.65 33.300000000000004 23.549999999999997 19.5 6 19.7 31.874999999999996 25.474999999999998 22.95 7 14.924999999999999 21.675 42.1 21.3 8 18.525 20.7 31.125000000000004 29.65 9 18.55 20.875 31.924999999999997 28.65 10 18.075 35.0 24.6 22.325 11 24.6 26.05 20.625 28.725 12 22.8 22.400000000000002 26.924999999999997 27.875 13 19.900000000000002 25.7 27.825 26.575 14 20.599999999999998 25.624999999999996 28.299999999999997 25.474999999999998 15 21.099999999999998 25.474999999999998 28.225 25.2 16 22.625 25.474999999999998 25.35 26.55 17 20.549999999999997 26.950000000000003 26.5 26.0 18 21.25 26.474999999999998 26.924999999999997 25.35 19 21.875 27.1 24.925 26.1 20 21.675 26.674999999999997 27.575 24.075 21 22.0 26.1 25.3 26.6 22 21.2 25.275 26.525 27.0 23 21.55 27.275 26.05 25.124999999999996 24 21.15 24.625 27.200000000000003 27.025 25 20.599999999999998 27.474999999999998 25.2 26.724999999999998 26 21.125 27.025 26.650000000000002 25.2 27 22.05 24.975 26.375 26.6 28 21.375 24.75 25.324999999999996 28.549999999999997 29 21.25 25.424999999999997 27.675 25.650000000000002 30 21.075 23.775 28.175 26.974999999999998 31 21.025 24.925 26.0 28.050000000000004 32 21.975 24.0 27.35 26.674999999999997 33 22.7 24.875 26.125 26.3 34 21.125 26.200000000000003 25.775 26.900000000000002 35 22.375 25.05 26.55 26.025 36 22.475 25.124999999999996 25.0 27.400000000000002 37 21.05 26.025 26.5 26.424999999999997 38 22.025 25.724999999999998 25.825 26.424999999999997 39 22.25 25.4 24.95 27.400000000000002 40 22.3 25.074999999999996 26.150000000000002 26.474999999999998 41 21.8 25.2 26.275 26.724999999999998 42 23.075000000000003 23.95 25.7 27.275 43 23.05 25.324999999999996 25.1 26.525 44 21.325 25.7 26.55 26.424999999999997 45 22.5 25.224999999999998 26.400000000000002 25.874999999999996 46 23.05 24.45 26.35 26.150000000000002 47 22.15 26.55 25.724999999999998 25.575 48 23.375 24.625 25.75 26.25 49 22.125 24.925 25.575 27.375 50 21.95 24.4 26.224999999999998 27.425 51 22.2 24.224999999999998 26.55 27.025 52 21.825 24.275 27.250000000000004 26.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.5 21 4.0 22 6.0 23 8.0 24 8.0 25 8.0 26 10.0 27 12.0 28 17.5 29 23.0 30 25.5 31 28.0 32 47.0 33 66.0 34 76.0 35 86.0 36 113.0 37 140.0 38 153.5 39 197.0 40 227.0 41 253.0 42 279.0 43 294.0 44 309.0 45 347.5 46 386.0 47 383.0 48 380.0 49 390.5 50 401.0 51 377.5 52 354.0 53 334.5 54 315.0 55 284.0 56 253.0 57 215.0 58 177.0 59 157.5 60 138.0 61 112.0 62 86.0 63 65.5 64 39.0 65 33.0 66 27.5 67 22.0 68 21.0 69 20.0 70 15.5 71 11.0 72 10.0 73 9.0 74 6.5 75 4.0 76 3.5 77 3.0 78 2.5 79 2.0 80 2.0 81 2.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.450000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra Read 200000 spots for SRR5423462.sra Written 200000 spots for SRR5423462.sra SRR ids: ['SRR5423462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lbqi5k67 SRR5423462.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423462 file size 703971 SRR5423462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423462 SRR5423462_1.fastq Input file: SRR5423462_1.fastq trimmed: SRR5423462-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 14:57:26 2025 >> started Wed Feb 12 14:57:28 2025 >> done (1.929s) 4000000 reads processed; of these: 163 ( 0.00%) short reads filtered out after trimming by size control 213 ( 0.01%) empty reads filtered out after trimming by size control 3999624 (99.99%) reads available; of these: 62528 ( 1.56%) trimmed reads available after processing 3937096 (98.44%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 6 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 7 0.00% 27 1 0.00% 28 6 0.00% 29 8 0.00% 30 8 0.00% 31 14 0.00% 32 20 0.00% 33 24 0.00% 34 22 0.00% 35 17 0.00% 36 35 0.00% 37 43 0.00% 38 37 0.00% 39 50 0.00% 40 59 0.00% 41 63 0.00% 42 99 0.00% 43 124 0.00% 44 203 0.01% 45 270 0.01% 46 396 0.01% 47 575 0.01% 48 1094 0.03% 49 2176 0.05% 50 6647 0.17% 51 50505 1.26% 52 3937096 98.44% 3999624 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=29 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=8 fanout-score=160.15 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=20.6 sequence=CTTCTTCTTCTC Started job on | Feb 12 14:57:41 Started mapping on | Feb 12 14:57:41 Finished on | Feb 12 14:57:45 Mapping speed, Million of reads per hour | 3599.66 Number of input reads | 3999624 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3594848 Uniquely mapped reads % | 89.88% Average mapped length | 51.85 Number of splices: Total | 473480 Number of splices: Annotated (sjdb) | 468242 Number of splices: GT/AG | 464945 Number of splices: GC/AG | 7660 Number of splices: AT/AC | 351 Number of splices: Non-canonical | 524 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318880 % of reads mapped to multiple loci | 7.97% Number of reads mapped to too many loci | 72768 % of reads mapped to too many loci | 1.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.32% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 85896 85896 85896 N_multimapping 318880 318880 318880 N_noFeature 104447 3562725 117142 N_ambiguous 33580 63 14111 UnstrandedReadsAssigned:3456821 PositiveStrandReadsAssigned:32060 NegativeStrandReadsAssigned:3463595 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423462 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423462-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,624 reads, 3,703,700 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,017 rounds 52401 SRR5423462.ke.tsv 34699 SRR5423462.se.tsv 87100 total ==> SRR5423462.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 70 10.9248 Potri.005G024800.1.v4.1 1035 936 1.00051 0.320135 Potri.004G059700.1.v4.1 961 862 7 2.4321 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 69.8728 7.35815 Potri.016G087400.1.v4.1 270 171 197 345.033 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 210 71.6333 ==> SRR5423462.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 57 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423462 completed mapping pipeline successfully