Starting /dee2/code/volunteer_pipeline.sh SRR5423463 current disk space = 3051605241856 free memory = 1581890396 SRR5423463 SRAfilesize a274889f8c24905a29584889618e0437 SRR5423463.sra SRR5423463.sra file validated SRR5423463 is single end SRR5423463 is conventional basespace SRR5423463 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423463_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.92725 33.0 31.0 34.0 30.0 34.0 2 32.14175 34.0 31.0 34.0 30.0 34.0 3 32.28 34.0 31.0 34.0 30.0 34.0 4 34.89975 37.0 35.0 37.0 32.0 37.0 5 35.644 37.0 35.0 37.0 33.0 37.0 6 35.6035 37.0 35.0 37.0 33.0 37.0 7 35.693 37.0 35.0 37.0 33.0 37.0 8 35.76625 37.0 35.0 37.0 33.0 37.0 9 37.46325 39.0 37.0 39.0 34.0 39.0 10 37.43 39.0 37.0 39.0 34.0 39.0 11 37.256 39.0 37.0 39.0 33.0 39.0 12 37.266 39.0 37.0 39.0 34.0 39.0 13 37.37375 39.0 37.0 39.0 34.0 39.0 14 38.7855 40.0 38.0 41.0 35.0 41.0 15 38.4955 40.0 38.0 41.0 34.0 41.0 16 38.688 40.0 38.0 41.0 34.0 41.0 17 38.6265 40.0 38.0 41.0 34.0 41.0 18 38.67 40.0 38.0 41.0 34.0 41.0 19 38.6335 40.0 38.0 41.0 34.0 41.0 20 38.6105 40.0 38.0 41.0 34.0 41.0 21 38.5305 40.0 38.0 41.0 34.0 41.0 22 38.47475 40.0 38.0 41.0 34.0 41.0 23 38.62775 40.0 38.0 41.0 34.0 41.0 24 38.59075 40.0 38.0 41.0 34.0 41.0 25 38.52375 40.0 38.0 41.0 34.0 41.0 26 38.50825 40.0 38.0 41.0 34.0 41.0 27 38.545 40.0 38.0 41.0 34.0 41.0 28 38.55225 40.0 38.0 41.0 34.0 41.0 29 38.5585 40.0 38.0 41.0 34.0 41.0 30 38.4315 40.0 38.0 41.0 34.0 41.0 31 38.16725 40.0 38.0 41.0 33.0 41.0 32 38.3755 40.0 38.0 41.0 34.0 41.0 33 38.07225 40.0 38.0 41.0 33.0 41.0 34 38.24025 40.0 38.0 41.0 33.0 41.0 35 38.13575 40.0 38.0 41.0 33.0 41.0 36 38.199 40.0 38.0 41.0 33.0 41.0 37 38.0875 40.0 38.0 41.0 33.0 41.0 38 38.011 40.0 37.0 41.0 33.0 41.0 39 37.832 40.0 37.0 41.0 33.0 41.0 40 37.921 40.0 37.0 41.0 33.0 41.0 41 37.67875 40.0 37.0 41.0 32.0 41.0 42 37.67825 40.0 37.0 41.0 32.0 41.0 43 37.82375 40.0 37.0 41.0 33.0 41.0 44 37.79375 40.0 37.0 41.0 32.0 41.0 45 37.58225 40.0 37.0 41.0 31.0 41.0 46 37.6795 40.0 37.0 41.0 32.0 41.0 47 37.44325 40.0 37.0 41.0 32.0 41.0 48 37.412 40.0 37.0 41.0 31.0 41.0 49 37.40275 40.0 36.0 41.0 31.0 41.0 50 37.28625 39.0 36.0 41.0 31.0 41.0 51 37.288 39.0 36.0 41.0 31.0 41.0 52 36.387 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 2.0 22 1.0 23 2.0 24 3.0 25 9.0 26 11.0 27 25.0 28 31.0 29 36.0 30 69.0 31 63.0 32 96.0 33 133.0 34 176.0 35 225.0 36 288.0 37 455.0 38 720.0 39 1644.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.857715430861724 11.072144288577155 8.942885771543088 51.12725450901804 2 18.725 16.725 38.224999999999994 26.325 3 20.974999999999998 20.4 25.650000000000002 32.975 4 23.65 26.5 21.05 28.799999999999997 5 23.9 32.0 24.3 19.8 6 18.025 33.5 26.25 22.225 7 15.625 21.6 41.9 20.875 8 18.6 20.275000000000002 31.574999999999996 29.549999999999997 9 19.325 20.875 33.775 26.025 10 19.45 34.849999999999994 24.075 21.625 11 25.15 25.424999999999997 20.95 28.475 12 22.825 21.45 26.150000000000002 29.575000000000003 13 20.25 25.924999999999997 27.05 26.775 14 20.95 24.775 27.250000000000004 27.025 15 20.65 25.3 28.075 25.974999999999998 16 22.125 26.05 25.624999999999996 26.200000000000003 17 21.175 24.75 27.0 27.075 18 21.65 24.95 26.25 27.150000000000002 19 21.425 26.0 26.5 26.075 20 22.475 25.95 25.025 26.55 21 21.349999999999998 24.675 26.575 27.400000000000002 22 21.125 24.625 26.85 27.400000000000002 23 22.925 24.975 26.275 25.825 24 21.224999999999998 25.55 27.025 26.200000000000003 25 21.825 25.224999999999998 25.8 27.150000000000002 26 21.8 24.15 27.325 26.724999999999998 27 21.775 24.275 27.3 26.650000000000002 28 22.125 24.575 25.775 27.525 29 21.725 25.974999999999998 26.875 25.424999999999997 30 20.724999999999998 25.275 25.275 28.725 31 22.0 24.5 26.525 26.974999999999998 32 22.325 24.15 27.175 26.35 33 22.375 25.3 25.45 26.875 34 20.724999999999998 25.900000000000002 27.025 26.35 35 22.35 24.65 26.400000000000002 26.6 36 22.375 24.25 26.275 27.1 37 20.549999999999997 26.224999999999998 26.525 26.700000000000003 38 22.400000000000002 25.324999999999996 25.45 26.825 39 22.325 24.275 26.75 26.650000000000002 40 21.475 25.174999999999997 25.624999999999996 27.725 41 21.675 25.224999999999998 27.525 25.575 42 21.75 25.3 26.575 26.375 43 21.175 24.625 26.6 27.6 44 22.075 24.675 26.974999999999998 26.275 45 21.975 24.5 26.25 27.275 46 21.075 24.575 26.0 28.349999999999998 47 22.5 24.825 26.950000000000003 25.724999999999998 48 22.325 24.0 27.3 26.375 49 23.0 22.575 25.650000000000002 28.775000000000002 50 22.125 24.95 26.174999999999997 26.75 51 22.275 23.549999999999997 26.150000000000002 28.025 52 23.25 24.675 24.575 27.500000000000004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 2.5 19 4.0 20 2.5 21 1.0 22 3.0 23 5.0 24 5.5 25 6.0 26 10.0 27 14.0 28 20.5 29 27.0 30 30.0 31 33.0 32 47.5 33 62.0 34 58.5 35 55.0 36 80.5 37 106.0 38 137.5 39 188.0 40 207.0 41 231.0 42 255.0 43 280.5 44 306.0 45 326.5 46 347.0 47 386.5 48 426.0 49 418.5 50 411.0 51 388.5 52 366.0 53 350.0 54 334.0 55 296.5 56 259.0 57 223.5 58 188.0 59 160.0 60 132.0 61 113.0 62 94.0 63 83.0 64 55.5 65 39.0 66 33.5 67 28.0 68 22.0 69 16.0 70 16.5 71 17.0 72 15.5 73 14.0 74 8.5 75 3.0 76 2.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14184755174155 98.2 2 0.7824331145885917 1.55 3 0.05047955577990913 0.15 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra Read 200000 spots for SRR5423463.sra Written 200000 spots for SRR5423463.sra SRR ids: ['SRR5423463.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nd6oa4c9 SRR5423463.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423463 file size 703986 SRR5423463 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423463 SRR5423463_1.fastq Input file: SRR5423463_1.fastq trimmed: SRR5423463-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:26:57 2025 >> started Wed Feb 12 15:27:00 2025 >> done (2.764s) 4000000 reads processed; of these: 146 ( 0.00%) short reads filtered out after trimming by size control 234 ( 0.01%) empty reads filtered out after trimming by size control 3999620 (99.99%) reads available; of these: 62627 ( 1.57%) trimmed reads available after processing 3936993 (98.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 1 0.00% 27 4 0.00% 28 14 0.00% 29 6 0.00% 30 8 0.00% 31 22 0.00% 32 18 0.00% 33 19 0.00% 34 18 0.00% 35 20 0.00% 36 32 0.00% 37 40 0.00% 38 38 0.00% 39 35 0.00% 40 62 0.00% 41 64 0.00% 42 80 0.00% 43 129 0.00% 44 192 0.00% 45 244 0.01% 46 363 0.01% 47 614 0.02% 48 1012 0.03% 49 2278 0.06% 50 6983 0.17% 51 50316 1.26% 52 3936993 98.43% 3999620 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=27 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=9 fanout-score=163.27 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=20.3 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:27:11 Started mapping on | Feb 12 15:27:11 Finished on | Feb 12 15:27:16 Mapping speed, Million of reads per hour | 2879.73 Number of input reads | 3999620 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3595632 Uniquely mapped reads % | 89.90% Average mapped length | 51.85 Number of splices: Total | 474073 Number of splices: Annotated (sjdb) | 468767 Number of splices: GT/AG | 465436 Number of splices: GC/AG | 7789 Number of splices: AT/AC | 311 Number of splices: Non-canonical | 537 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317591 % of reads mapped to multiple loci | 7.94% Number of reads mapped to too many loci | 72849 % of reads mapped to too many loci | 1.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.33% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 86397 86397 86397 N_multimapping 317591 317591 317591 N_noFeature 104409 3563719 116841 N_ambiguous 33747 66 14228 UnstrandedReadsAssigned:3457476 PositiveStrandReadsAssigned:31847 NegativeStrandReadsAssigned:3464563 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423463 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423463-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,620 reads, 3,702,433 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR5423463.ke.tsv 34699 SRR5423463.se.tsv 87100 total ==> SRR5423463.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 45 7.02461 Potri.005G024800.1.v4.1 1035 936 6 1.92026 Potri.004G059700.1.v4.1 961 862 8 2.78014 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 69.3814 7.30799 Potri.016G087400.1.v4.1 270 171 190 332.845 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 188 64.1428 ==> SRR5423463.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 70 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423463 completed mapping pipeline successfully