Starting /dee2/code/volunteer_pipeline.sh SRR5423464 current disk space = 3051652980736 free memory = 1578119052 SRR5423464 SRAfilesize 66d2924efb576f43de97ef56a99d9690 SRR5423464.sra SRR5423464.sra file validated SRR5423464 is single end SRR5423464 is conventional basespace SRR5423464 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423464_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.427 34.0 31.0 34.0 30.0 34.0 2 32.582 34.0 31.0 34.0 31.0 34.0 3 32.67975 34.0 31.0 34.0 31.0 34.0 4 36.07 37.0 35.0 37.0 35.0 37.0 5 36.05525 37.0 35.0 37.0 35.0 37.0 6 36.0155 37.0 35.0 37.0 35.0 37.0 7 35.986 37.0 35.0 37.0 35.0 37.0 8 36.00725 37.0 35.0 37.0 35.0 37.0 9 37.757 39.0 38.0 39.0 35.0 39.0 10 37.7135 39.0 37.0 39.0 35.0 39.0 11 37.7825 39.0 38.0 39.0 35.0 39.0 12 37.81075 39.0 38.0 39.0 35.0 39.0 13 37.68175 39.0 38.0 39.0 35.0 39.0 14 39.028 40.0 38.0 41.0 35.0 41.0 15 39.0075 40.0 38.0 41.0 36.0 41.0 16 38.9005 40.0 38.0 41.0 35.0 41.0 17 39.0345 40.0 38.0 41.0 36.0 41.0 18 38.99575 40.0 38.0 41.0 36.0 41.0 19 38.994 40.0 39.0 41.0 35.0 41.0 20 39.10825 40.0 39.0 41.0 36.0 41.0 21 38.9385 40.0 38.0 41.0 35.0 41.0 22 38.87125 40.0 38.0 41.0 35.0 41.0 23 38.93075 40.0 38.0 41.0 35.0 41.0 24 39.055 40.0 39.0 41.0 36.0 41.0 25 38.9715 40.0 39.0 41.0 35.0 41.0 26 38.833 40.0 38.0 41.0 35.0 41.0 27 38.861 40.0 38.0 41.0 35.0 41.0 28 38.6065 40.0 38.0 41.0 34.0 41.0 29 38.7945 40.0 38.0 41.0 35.0 41.0 30 38.75775 40.0 38.0 41.0 35.0 41.0 31 38.754 40.0 38.0 41.0 35.0 41.0 32 38.7705 40.0 38.0 41.0 35.0 41.0 33 38.7555 40.0 38.0 41.0 35.0 41.0 34 38.72475 40.0 38.0 41.0 35.0 41.0 35 38.615 40.0 38.0 41.0 34.0 41.0 36 38.5975 40.0 38.0 41.0 34.0 41.0 37 38.44625 40.0 38.0 41.0 34.0 41.0 38 38.30825 40.0 38.0 41.0 33.0 41.0 39 38.42075 40.0 38.0 41.0 33.0 41.0 40 38.31975 40.0 38.0 41.0 33.0 41.0 41 38.224 40.0 38.0 41.0 33.0 41.0 42 38.1505 40.0 38.0 41.0 33.0 41.0 43 38.18025 40.0 38.0 41.0 33.0 41.0 44 38.09325 40.0 38.0 41.0 33.0 41.0 45 37.961 40.0 37.0 41.0 33.0 41.0 46 37.865 40.0 37.0 41.0 33.0 41.0 47 37.845 40.0 37.0 41.0 33.0 41.0 48 37.6725 40.0 37.0 41.0 32.0 41.0 49 37.61575 40.0 37.0 41.0 32.0 41.0 50 37.5135 40.0 36.0 41.0 32.0 41.0 51 37.526 40.0 36.0 41.0 32.0 41.0 52 36.524 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1208 1 0.0 1208 2 0.0 1208 3 0.0 1208 4 0.0 1208 5 0.0 1208 6 0.0 1208 7 0.0 1208 8 0.0 1208 9 0.0 1208 10 0.0 1208 11 0.0 1208 12 0.0 1208 13 0.0 1208 14 0.0 1208 15 0.0 1208 16 0.0 1208 17 0.0 1208 18 0.0 1208 19 0.0 1208 20 0.0 1208 21 0.0 1208 22 0.0 1208 23 0.0 1208 24 0.0 1208 25 0.0 1208 26 0.0 1208 27 0.0 1208 28 0.0 1208 29 0.0 1208 30 0.0 1208 31 0.0 1208 32 0.0 1208 33 0.0 1208 34 0.0 1208 35 0.0 1208 36 0.0 1208 37 0.0 1208 38 0.0 1208 39 0.0 1208 40 0.0 1208 41 0.0 1208 42 0.0 1208 43 0.0 1208 44 0.0 1208 45 0.0 1208 46 0.0 1208 47 0.0 1208 48 0.0 1208 49 0.0 1208 50 0.0 1208 51 0.0 1208 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 3.0 22 1.0 23 3.0 24 4.0 25 5.0 26 6.0 27 15.0 28 25.0 29 34.0 30 47.0 31 56.0 32 78.0 33 103.0 34 127.0 35 185.0 36 260.0 37 393.0 38 704.0 39 1938.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.53607214428858 10.245490981963929 9.669338677354709 49.54909819639279 2 20.549999999999997 17.65 36.95 24.85 3 20.1 20.200000000000003 25.3 34.4 4 23.7 29.25 22.1 24.95 5 24.075 32.824999999999996 23.825 19.275000000000002 6 18.875 32.925 25.324999999999996 22.875 7 16.650000000000002 21.3 41.349999999999994 20.7 8 19.575 20.65 30.775000000000002 28.999999999999996 9 18.175 20.7 33.2 27.925 10 19.3 37.0 23.225 20.474999999999998 11 23.849999999999998 25.374999999999996 20.9 29.875 12 20.95 22.575 26.450000000000003 30.025000000000002 13 20.724999999999998 26.1 26.674999999999997 26.5 14 21.375 24.975 28.375 25.275 15 20.5 24.6 27.500000000000004 27.400000000000002 16 21.85 25.874999999999996 25.85 26.424999999999997 17 21.975 25.224999999999998 27.625 25.174999999999997 18 19.875 25.650000000000002 27.6 26.875 19 22.45 25.45 25.974999999999998 26.125 20 21.275 25.224999999999998 27.150000000000002 26.35 21 21.425 24.7 26.05 27.825 22 21.75543885971493 25.881470367591895 26.981745436359088 25.381345336334082 23 21.425 25.724999999999998 27.224999999999998 25.624999999999996 24 21.65 24.65 26.125 27.575 25 21.15 25.775 25.15 27.925 26 21.45 24.75 27.925 25.874999999999996 27 21.575 25.074999999999996 26.025 27.325 28 22.1 24.75 26.775 26.375 29 21.8 24.425 26.900000000000002 26.875 30 22.05 22.2 28.575 27.175 31 22.3 26.125 25.575 26.0 32 21.425 26.05 26.575 25.95 33 21.625 24.175 27.525 26.674999999999997 34 24.2 23.325000000000003 25.95 26.525 35 21.15 24.8 27.175 26.875 36 21.825 24.95 25.674999999999997 27.55 37 21.55 26.224999999999998 25.424999999999997 26.8 38 22.175 25.624999999999996 27.175 25.025 39 22.825 23.674999999999997 25.424999999999997 28.075 40 21.224999999999998 25.424999999999997 26.375 26.974999999999998 41 22.3 24.5 27.224999999999998 25.974999999999998 42 22.775000000000002 23.45 26.0 27.775 43 21.925 25.6 25.8 26.674999999999997 44 22.675 25.1 26.325 25.900000000000002 45 21.605401350337583 24.50612653163291 24.981245311327832 28.907226806701676 46 21.85 25.25 26.25 26.650000000000002 47 22.35 24.625 26.375 26.650000000000002 48 21.8304576144036 24.15603900975244 26.431607901975497 27.581895473868467 49 21.705426356589147 25.206301575393848 25.95648912228057 27.131782945736433 50 22.230557639409852 25.481370342585645 25.756439109777446 26.531632908227053 51 22.736368184092047 24.362181090545274 25.337668834417208 27.56378189094547 52 22.330582645661416 26.081520380095025 25.056264066016503 26.531632908227053 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.5 21 2.0 22 2.0 23 2.0 24 5.0 25 8.0 26 12.5 27 17.0 28 21.0 29 25.0 30 28.0 31 31.0 32 43.0 33 55.0 34 63.0 35 71.0 36 98.5 37 126.0 38 135.5 39 177.5 40 210.0 41 235.0 42 260.0 43 273.5 44 287.0 45 336.0 46 385.0 47 385.0 48 385.0 49 407.5 50 430.0 51 413.0 52 396.0 53 363.5 54 331.0 55 297.0 56 263.0 57 232.0 58 201.0 59 161.0 60 121.0 61 104.0 62 87.0 63 69.5 64 43.5 65 35.0 66 30.0 67 25.0 68 20.0 69 15.0 70 15.0 71 15.0 72 11.5 73 8.0 74 7.0 75 6.0 76 3.5 77 1.0 78 1.0 79 1.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.025 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.025 46 0.0 47 0.0 48 0.025 49 0.025 50 0.025 51 0.05 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5787619526925012 1.15 3 0.0 0.0 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra Read 200000 spots for SRR5423464.sra Written 200000 spots for SRR5423464.sra SRR ids: ['SRR5423464.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ln5njtzh SRR5423464.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423464 file size 703977 SRR5423464 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423464 SRR5423464_1.fastq Input file: SRR5423464_1.fastq trimmed: SRR5423464-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:22:38 2025 >> started Wed Feb 12 15:22:39 2025 >> done (1.706s) 4000000 reads processed; of these: 161 ( 0.00%) short reads filtered out after trimming by size control 239 ( 0.01%) empty reads filtered out after trimming by size control 3999600 (99.99%) reads available; of these: 56071 ( 1.40%) trimmed reads available after processing 3943529 (98.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 3 0.00% 29 1 0.00% 30 8 0.00% 31 10 0.00% 32 7 0.00% 33 7 0.00% 34 17 0.00% 35 18 0.00% 36 19 0.00% 37 16 0.00% 38 23 0.00% 39 29 0.00% 40 40 0.00% 41 47 0.00% 42 59 0.00% 43 86 0.00% 44 103 0.00% 45 215 0.01% 46 271 0.01% 47 468 0.01% 48 798 0.02% 49 1816 0.05% 50 6104 0.15% 51 45889 1.15% 52 3943529 98.60% 3999600 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=29 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=11 fanout-score=163.01 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=20.1 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:22:50 Started mapping on | Feb 12 15:22:50 Finished on | Feb 12 15:22:55 Mapping speed, Million of reads per hour | 2879.71 Number of input reads | 3999600 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3596221 Uniquely mapped reads % | 89.91% Average mapped length | 51.85 Number of splices: Total | 473373 Number of splices: Annotated (sjdb) | 468164 Number of splices: GT/AG | 464796 Number of splices: GC/AG | 7722 Number of splices: AT/AC | 365 Number of splices: Non-canonical | 490 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316931 % of reads mapped to multiple loci | 7.92% Number of reads mapped to too many loci | 73741 % of reads mapped to too many loci | 1.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.31% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 86448 86448 86448 N_multimapping 316931 316931 316931 N_noFeature 105185 3564194 117670 N_ambiguous 33823 69 14239 UnstrandedReadsAssigned:3457213 PositiveStrandReadsAssigned:31958 NegativeStrandReadsAssigned:3464312 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423464 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423464-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,600 reads, 3,703,662 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,011 rounds 52401 SRR5423464.ke.tsv 34699 SRR5423464.se.tsv 87100 total ==> SRR5423464.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 64 9.99176 Potri.005G024800.1.v4.1 1035 936 1 0.320082 Potri.004G059700.1.v4.1 961 862 8 2.78048 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 65.7333 6.92458 Potri.016G087400.1.v4.1 270 171 202 353.91 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.178971 Potri.012G127500.1.v4.1 977 878 218 74.3874 ==> SRR5423464.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 78 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423464 completed mapping pipeline successfully