Starting /dee2/code/volunteer_pipeline.sh SRR5423465 current disk space = 3051747442688 free memory = 1467425432 SRR5423465 SRAfilesize 237806da1bace8e552d2b4dbe2c6bff1 SRR5423465.sra SRR5423465.sra file validated SRR5423465 is single end SRR5423465 is conventional basespace SRR5423465 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68125 34.0 31.0 34.0 31.0 34.0 2 32.786 34.0 31.0 34.0 31.0 34.0 3 32.8145 34.0 31.0 34.0 31.0 34.0 4 36.217 37.0 37.0 37.0 35.0 37.0 5 36.18025 37.0 37.0 37.0 35.0 37.0 6 36.17875 37.0 37.0 37.0 35.0 37.0 7 36.19475 37.0 36.0 37.0 35.0 37.0 8 36.17975 37.0 36.0 37.0 35.0 37.0 9 38.01625 39.0 38.0 39.0 35.0 39.0 10 37.808 39.0 38.0 39.0 35.0 39.0 11 37.87575 39.0 38.0 39.0 35.0 39.0 12 37.78825 39.0 38.0 39.0 35.0 39.0 13 37.891 39.0 38.0 39.0 35.0 39.0 14 39.27475 41.0 39.0 41.0 36.0 41.0 15 39.12175 41.0 39.0 41.0 36.0 41.0 16 39.233 41.0 39.0 41.0 36.0 41.0 17 39.11025 41.0 39.0 41.0 36.0 41.0 18 39.18025 40.0 39.0 41.0 36.0 41.0 19 39.252 41.0 39.0 41.0 36.0 41.0 20 39.28075 40.0 39.0 41.0 36.0 41.0 21 39.13725 40.0 39.0 41.0 36.0 41.0 22 39.009 40.0 39.0 41.0 35.0 41.0 23 39.13525 40.0 39.0 41.0 36.0 41.0 24 39.20775 40.0 39.0 41.0 36.0 41.0 25 39.21425 41.0 39.0 41.0 36.0 41.0 26 39.1585 41.0 39.0 41.0 36.0 41.0 27 39.089 40.0 39.0 41.0 36.0 41.0 28 39.15875 40.0 39.0 41.0 36.0 41.0 29 39.106 40.0 39.0 41.0 36.0 41.0 30 38.86125 40.0 38.0 41.0 35.0 41.0 31 38.8495 40.0 39.0 41.0 35.0 41.0 32 38.69175 40.0 38.0 41.0 35.0 41.0 33 38.618 40.0 38.0 41.0 35.0 41.0 34 38.6945 40.0 38.0 41.0 35.0 41.0 35 38.677 40.0 38.0 41.0 35.0 41.0 36 38.61225 40.0 38.0 41.0 35.0 41.0 37 38.618 40.0 38.0 41.0 34.0 41.0 38 38.56675 40.0 38.0 41.0 34.0 41.0 39 38.51125 40.0 38.0 41.0 35.0 41.0 40 38.43775 40.0 38.0 41.0 34.0 41.0 41 38.35275 40.0 38.0 41.0 34.0 41.0 42 38.358 40.0 38.0 41.0 34.0 41.0 43 38.2645 40.0 38.0 41.0 34.0 41.0 44 38.20175 40.0 38.0 41.0 33.0 41.0 45 38.11825 40.0 38.0 41.0 33.0 41.0 46 37.98025 40.0 38.0 41.0 33.0 41.0 47 37.97425 40.0 38.0 41.0 33.0 41.0 48 37.71 40.0 37.0 41.0 32.0 41.0 49 37.812 40.0 37.0 41.0 33.0 41.0 50 37.78575 40.0 37.0 41.0 33.0 41.0 51 37.612 40.0 37.0 41.0 32.0 41.0 52 36.249 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1302 1 0.0 1302 2 0.0 1302 3 0.0 1302 4 0.0 1302 5 0.0 1302 6 0.0 1302 7 0.0 1302 8 0.0 1302 9 0.0 1302 10 0.0 1302 11 0.0 1302 12 0.0 1302 13 0.0 1302 14 0.0 1302 15 0.0 1302 16 0.0 1302 17 0.0 1302 18 0.0 1302 19 0.0 1302 20 0.0 1302 21 0.0 1302 22 0.0 1302 23 0.0 1302 24 0.0 1302 25 0.0 1302 26 0.0 1302 27 0.0 1302 28 0.0 1302 29 0.0 1302 30 0.0 1302 31 0.0 1302 32 0.0 1302 33 0.0 1302 34 0.0 1302 35 0.0 1302 36 0.0 1302 37 0.0 1302 38 0.0 1302 39 0.0 1302 40 0.0 1302 41 0.0 1302 42 0.0 1302 43 0.0 1302 44 0.0 1302 45 0.0 1302 46 0.0 1302 47 0.0 1302 48 0.0 1302 49 0.0 1302 50 0.0 1302 51 0.0 1302 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 0.0 21 4.0 22 0.0 23 4.0 24 7.0 25 11.0 26 11.0 27 11.0 28 17.0 29 32.0 30 41.0 31 46.0 32 69.0 33 100.0 34 116.0 35 154.0 36 227.0 37 323.0 38 694.0 39 2119.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.51302605210421 10.370741482965933 8.842685370741483 49.27354709418837 2 19.975 15.475 38.7 25.85 3 20.974999999999998 19.325 24.825 34.875 4 24.525 28.825 20.775 25.874999999999996 5 23.05 33.050000000000004 24.2 19.7 6 19.325 32.375 26.0 22.3 7 16.0 21.775 40.325 21.9 8 18.4 20.275000000000002 31.0 30.325000000000003 9 19.325 20.325 32.5 27.85 10 18.775 35.325 26.125 19.775000000000002 11 23.525 25.5 21.45 29.525000000000002 12 22.125 21.075 28.199999999999996 28.599999999999998 13 21.375 24.85 27.800000000000004 25.974999999999998 14 20.150000000000002 26.3 28.175 25.374999999999996 15 20.65 24.2 27.825 27.325 16 22.575 26.224999999999998 25.674999999999997 25.525 17 21.6 26.275 26.6 25.525 18 22.5 26.05 25.900000000000002 25.55 19 21.4 26.075 26.1 26.424999999999997 20 21.175 25.900000000000002 26.55 26.375 21 21.05 24.825 27.525 26.6 22 21.4 25.874999999999996 26.825 25.900000000000002 23 21.85 25.55 26.125 26.474999999999998 24 20.25 25.5 26.700000000000003 27.55 25 21.975 24.725 25.775 27.525 26 21.025 25.5 26.5 26.974999999999998 27 21.099999999999998 25.324999999999996 26.775 26.8 28 22.3 24.25 26.974999999999998 26.474999999999998 29 22.35 25.6 25.424999999999997 26.625 30 22.5 23.549999999999997 26.950000000000003 27.0 31 20.5 25.35 26.35 27.800000000000004 32 22.025 26.474999999999998 25.224999999999998 26.275 33 20.9 25.2 26.0 27.900000000000002 34 22.0 25.25 24.349999999999998 28.4 35 22.45 25.45 26.150000000000002 25.95 36 21.85 25.525 26.025 26.6 37 21.7 25.75 25.6 26.950000000000003 38 22.35 25.2 25.074999999999996 27.375 39 20.925 24.525 28.15 26.400000000000002 40 22.25 25.7 25.75 26.3 41 21.75 24.5 27.224999999999998 26.525 42 21.85 24.05 27.625 26.474999999999998 43 21.8 24.8 25.8 27.6 44 23.35 24.15 26.325 26.174999999999997 45 21.725 24.85 26.474999999999998 26.950000000000003 46 22.1 24.55 25.5 27.85 47 22.1 24.175 27.025 26.700000000000003 48 21.7 22.875 27.400000000000002 28.025 49 22.1 25.2 25.674999999999997 27.025 50 22.575 25.775 24.9 26.75 51 22.625 23.25 28.275 25.85 52 23.3 25.374999999999996 24.775 26.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 4.0 20 4.5 21 5.0 22 5.0 23 5.0 24 6.0 25 7.0 26 10.0 27 13.0 28 18.5 29 24.0 30 30.5 31 37.0 32 43.5 33 50.0 34 63.5 35 77.0 36 97.5 37 118.0 38 132.0 39 172.5 40 199.0 41 232.5 42 266.0 43 294.5 44 323.0 45 349.0 46 375.0 47 380.5 48 386.0 49 377.0 50 368.0 51 369.5 52 371.0 53 363.0 54 355.0 55 308.0 56 261.0 57 235.0 58 209.0 59 188.0 60 167.0 61 126.0 62 85.0 63 64.5 64 41.5 65 39.0 66 29.5 67 20.0 68 19.0 69 18.0 70 14.0 71 10.0 72 9.5 73 9.0 74 6.0 75 3.0 76 2.5 77 2.0 78 2.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra Read 200000 spots for SRR5423465.sra Written 200000 spots for SRR5423465.sra SRR ids: ['SRR5423465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u6iq_tcy SRR5423465.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423465 file size 703999 SRR5423465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423465 SRR5423465_1.fastq Input file: SRR5423465_1.fastq trimmed: SRR5423465-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:14:09 2025 >> started Wed Feb 12 15:14:11 2025 >> done (1.755s) 4000000 reads processed; of these: 150 ( 0.00%) short reads filtered out after trimming by size control 205 ( 0.01%) empty reads filtered out after trimming by size control 3999645 (99.99%) reads available; of these: 56261 ( 1.41%) trimmed reads available after processing 3943384 (98.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 7 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 4 0.00% 25 7 0.00% 26 2 0.00% 27 4 0.00% 28 7 0.00% 29 7 0.00% 30 7 0.00% 31 4 0.00% 32 13 0.00% 33 19 0.00% 34 19 0.00% 35 16 0.00% 36 27 0.00% 37 22 0.00% 38 23 0.00% 39 31 0.00% 40 54 0.00% 41 54 0.00% 42 68 0.00% 43 84 0.00% 44 150 0.00% 45 227 0.01% 46 332 0.01% 47 448 0.01% 48 831 0.02% 49 1946 0.05% 50 5786 0.14% 51 46045 1.15% 52 3943384 98.59% 3999645 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=29 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=9 fanout-score=155.30 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=20.0 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:14:31 Started mapping on | Feb 12 15:14:31 Finished on | Feb 12 15:14:36 Mapping speed, Million of reads per hour | 2879.74 Number of input reads | 3999645 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3594265 Uniquely mapped reads % | 89.86% Average mapped length | 51.85 Number of splices: Total | 473828 Number of splices: Annotated (sjdb) | 468544 Number of splices: GT/AG | 465330 Number of splices: GC/AG | 7659 Number of splices: AT/AC | 331 Number of splices: Non-canonical | 508 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318946 % of reads mapped to multiple loci | 7.97% Number of reads mapped to too many loci | 73347 % of reads mapped to too many loci | 1.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.32% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 86434 86434 86434 N_multimapping 318946 318946 318946 N_noFeature 104346 3562609 116827 N_ambiguous 33558 62 14344 UnstrandedReadsAssigned:3456361 PositiveStrandReadsAssigned:31594 NegativeStrandReadsAssigned:3463094 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423465 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423465-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,645 reads, 3,705,817 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,009 rounds 52401 SRR5423465.ke.tsv 34699 SRR5423465.se.tsv 87100 total ==> SRR5423465.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 64 9.98432 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 8.52199 2.9597 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 59.6655 6.28069 Potri.016G087400.1.v4.1 270 171 189 330.887 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 192 65.4667 ==> SRR5423465.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 72 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423465 completed mapping pipeline successfully