Starting /dee2/code/volunteer_pipeline.sh SRR5423466 current disk space = 3051692191744 free memory = 1058870836 SRR5423466 SRAfilesize f2581d8959901c5006ed2d7c0994c95f SRR5423466.sra SRR5423466.sra file validated SRR5423466 is single end SRR5423466 is conventional basespace SRR5423466 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423466_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.705 31.0 31.0 34.0 30.0 34.0 2 31.96375 33.0 31.0 34.0 30.0 34.0 3 32.12575 34.0 31.0 34.0 30.0 34.0 4 33.52725 37.0 33.0 37.0 26.0 37.0 5 35.05325 37.0 35.0 37.0 32.0 37.0 6 35.42775 37.0 35.0 37.0 33.0 37.0 7 35.5815 37.0 35.0 37.0 33.0 37.0 8 35.57025 37.0 35.0 37.0 33.0 37.0 9 37.418 39.0 37.0 39.0 34.0 39.0 10 37.43475 39.0 37.0 39.0 34.0 39.0 11 37.28875 39.0 37.0 39.0 34.0 39.0 12 37.192 39.0 37.0 39.0 33.0 39.0 13 37.225 39.0 37.0 39.0 33.0 39.0 14 38.52675 40.0 38.0 41.0 34.0 41.0 15 38.52175 40.0 38.0 41.0 34.0 41.0 16 38.47725 40.0 38.0 41.0 34.0 41.0 17 38.45475 40.0 38.0 41.0 33.0 41.0 18 38.41325 40.0 38.0 41.0 33.0 41.0 19 38.39675 40.0 38.0 41.0 34.0 41.0 20 38.4525 40.0 38.0 41.0 34.0 41.0 21 38.46625 40.0 38.0 41.0 34.0 41.0 22 38.50775 40.0 38.0 41.0 34.0 41.0 23 38.41175 40.0 38.0 41.0 34.0 41.0 24 38.29875 40.0 38.0 41.0 34.0 41.0 25 38.41275 40.0 38.0 41.0 34.0 41.0 26 38.365 40.0 38.0 41.0 34.0 41.0 27 38.202 40.0 38.0 41.0 33.0 41.0 28 38.1535 40.0 38.0 41.0 33.0 41.0 29 38.20875 40.0 38.0 41.0 34.0 41.0 30 37.96825 40.0 37.0 41.0 33.0 41.0 31 38.06475 40.0 38.0 41.0 33.0 41.0 32 37.90625 40.0 37.0 41.0 33.0 41.0 33 38.2105 40.0 38.0 41.0 33.0 41.0 34 37.97375 40.0 37.0 41.0 33.0 41.0 35 38.19475 40.0 38.0 41.0 33.0 41.0 36 37.95125 40.0 37.0 41.0 33.0 41.0 37 38.066 40.0 37.0 41.0 33.0 41.0 38 37.8505 40.0 37.0 41.0 33.0 41.0 39 37.932 40.0 37.0 41.0 33.0 41.0 40 37.58725 40.0 37.0 41.0 31.0 41.0 41 37.70075 40.0 37.0 41.0 32.0 41.0 42 37.71 40.0 37.0 41.0 32.0 41.0 43 37.36625 40.0 36.0 41.0 31.0 41.0 44 37.334 40.0 36.0 41.0 31.0 41.0 45 37.12525 39.0 36.0 41.0 30.0 41.0 46 37.294 39.0 36.0 41.0 31.0 41.0 47 37.08875 39.0 36.0 41.0 31.0 41.0 48 37.20925 39.0 36.0 41.0 31.0 41.0 49 37.23325 39.0 36.0 41.0 31.0 41.0 50 37.31175 39.0 36.0 41.0 31.0 41.0 51 37.4385 39.0 36.0 41.0 32.0 41.0 52 36.51725 38.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1313 1 0.0 1313 2 0.0 1313 3 0.0 1313 4 0.0 1313 5 0.0 1313 6 0.0 1313 7 0.0 1313 8 0.0 1313 9 0.0 1313 10 0.0 1313 11 0.0 1313 12 0.0 1313 13 0.0 1313 14 0.0 1313 15 0.0 1313 16 0.0 1313 17 0.0 1313 18 0.0 1313 19 0.0 1313 20 0.0 1313 21 0.0 1313 22 0.0 1313 23 0.0 1313 24 0.0 1313 25 0.0 1313 26 0.0 1313 27 0.0 1313 28 0.0 1313 29 0.0 1313 30 0.0 1313 31 0.0 1313 32 0.0 1313 33 0.0 1313 34 0.0 1313 35 0.0 1313 36 0.0 1313 37 0.0 1313 38 0.0 1313 39 0.0 1313 40 0.0 1313 41 0.0 1313 42 0.0 1313 43 0.0 1313 44 0.0 1313 45 0.0 1313 46 0.0 1313 47 0.0 1313 48 0.0 1313 49 0.0 1313 50 0.0 1313 51 0.0 1313 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 6.0 23 1.0 24 10.0 25 11.0 26 16.0 27 15.0 28 24.0 29 56.0 30 64.0 31 105.0 32 95.0 33 145.0 34 178.0 35 230.0 36 345.0 37 450.0 38 747.0 39 1489.0 40 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.391130042595844 11.550989726885492 8.594337258832372 50.463542971686294 2 20.3 17.224999999999998 37.425000000000004 25.05 3 19.900000000000002 20.9 25.4 33.800000000000004 4 24.875 26.775 23.025000000000002 25.324999999999996 5 21.95 33.125 24.175 20.75 6 18.425 33.5 26.3 21.775 7 15.075 21.925 42.199999999999996 20.8 8 19.25 20.674999999999997 30.049999999999997 30.025000000000002 9 18.775 21.5 32.875 26.85 10 20.3 36.075 24.075 19.55 11 22.875 26.400000000000002 21.3 29.425 12 21.525 22.2 26.950000000000003 29.325000000000003 13 19.900000000000002 25.3 28.000000000000004 26.8 14 20.325 26.424999999999997 27.474999999999998 25.775 15 21.025 24.55 27.85 26.575 16 21.725 24.474999999999998 27.250000000000004 26.55 17 22.3 24.6 26.575 26.525 18 20.825 24.975 28.599999999999998 25.6 19 22.05 25.3 25.1 27.55 20 22.0 25.75 26.625 25.624999999999996 21 21.05 26.125 27.250000000000004 25.575 22 22.525000000000002 24.525 26.275 26.674999999999997 23 21.25 27.175 25.974999999999998 25.6 24 22.325 24.55 26.224999999999998 26.900000000000002 25 21.099999999999998 24.825 27.224999999999998 26.85 26 21.475 25.4 27.3 25.825 27 21.2 23.3 28.15 27.35 28 22.175 25.25 26.174999999999997 26.400000000000002 29 21.65 26.025 26.325 26.0 30 22.325 24.15 26.200000000000003 27.325 31 21.275 24.95 26.8 26.974999999999998 32 21.825 25.275 27.075 25.825 33 22.05 24.15 27.175 26.625 34 21.0 26.075 26.174999999999997 26.75 35 22.575 26.025 25.900000000000002 25.5 36 21.725 24.175 28.125 25.974999999999998 37 21.224999999999998 26.05 25.775 26.950000000000003 38 22.15 24.5 26.400000000000002 26.950000000000003 39 22.15 24.525 26.775 26.55 40 22.325 25.1 25.45 27.125 41 21.775 25.275 25.525 27.425 42 20.8 24.325 27.750000000000004 27.125 43 22.25 25.974999999999998 25.474999999999998 26.3 44 21.625 25.174999999999997 26.924999999999997 26.275 45 21.025 24.15 28.749999999999996 26.075 46 22.825 24.075 26.174999999999997 26.924999999999997 47 22.625 24.975 26.474999999999998 25.924999999999997 48 21.630407601900476 24.731182795698924 25.681420355088775 27.956989247311824 49 22.025 25.4 25.95 26.625 50 22.025 24.925 26.525 26.525 51 21.475 24.099999999999998 27.0 27.425 52 23.05 23.474999999999998 26.950000000000003 26.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.0 20 1.0 21 2.0 22 4.0 23 6.0 24 7.5 25 9.0 26 11.0 27 13.0 28 17.5 29 22.0 30 35.0 31 48.0 32 57.5 33 67.0 34 79.5 35 92.0 36 105.5 37 119.0 38 130.0 39 168.5 40 196.0 41 226.0 42 256.0 43 295.5 44 335.0 45 351.0 46 367.0 47 373.0 48 379.0 49 399.0 50 419.0 51 397.5 52 376.0 53 349.5 54 323.0 55 302.5 56 282.0 57 232.5 58 183.0 59 153.0 60 123.0 61 112.5 62 102.0 63 76.0 64 40.0 65 30.0 66 27.5 67 25.0 68 18.0 69 11.0 70 8.0 71 5.0 72 5.0 73 5.0 74 5.5 75 6.0 76 4.0 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra Read 200000 spots for SRR5423466.sra Written 200000 spots for SRR5423466.sra SRR ids: ['SRR5423466.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4goyiv7f SRR5423466.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423466 file size 703967 SRR5423466 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423466 SRR5423466_1.fastq Input file: SRR5423466_1.fastq trimmed: SRR5423466-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:19:23 2025 >> started Wed Feb 12 15:19:25 2025 >> done (2.212s) 4000000 reads processed; of these: 159 ( 0.00%) short reads filtered out after trimming by size control 229 ( 0.01%) empty reads filtered out after trimming by size control 3999612 (99.99%) reads available; of these: 61476 ( 1.54%) trimmed reads available after processing 3938136 (98.46%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 5 0.00% 28 6 0.00% 29 7 0.00% 30 12 0.00% 31 18 0.00% 32 10 0.00% 33 17 0.00% 34 13 0.00% 35 27 0.00% 36 30 0.00% 37 42 0.00% 38 35 0.00% 39 55 0.00% 40 63 0.00% 41 67 0.00% 42 88 0.00% 43 127 0.00% 44 188 0.00% 45 245 0.01% 46 397 0.01% 47 569 0.01% 48 1030 0.03% 49 2255 0.06% 50 6745 0.17% 51 49407 1.24% 52 3938136 98.46% 3999612 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=27 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=9 fanout-score=167.21 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=20.9 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:19:38 Started mapping on | Feb 12 15:19:38 Finished on | Feb 12 15:19:43 Mapping speed, Million of reads per hour | 2879.72 Number of input reads | 3999612 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3595158 Uniquely mapped reads % | 89.89% Average mapped length | 51.85 Number of splices: Total | 472201 Number of splices: Annotated (sjdb) | 466991 Number of splices: GT/AG | 463541 Number of splices: GC/AG | 7767 Number of splices: AT/AC | 357 Number of splices: Non-canonical | 536 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317617 % of reads mapped to multiple loci | 7.94% Number of reads mapped to too many loci | 73103 % of reads mapped to too many loci | 1.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 86837 86837 86837 N_multimapping 317617 317617 317617 N_noFeature 105008 3563372 117335 N_ambiguous 33680 68 14176 UnstrandedReadsAssigned:3456470 PositiveStrandReadsAssigned:31718 NegativeStrandReadsAssigned:3463647 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423466 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423466-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,612 reads, 3,699,096 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR5423466.ke.tsv 34699 SRR5423466.se.tsv 87100 total ==> SRR5423466.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 62 9.68861 Potri.005G024800.1.v4.1 1035 936 3 0.961148 Potri.004G059700.1.v4.1 961 862 11.6004 4.03561 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 57.7969 6.09424 Potri.016G087400.1.v4.1 270 171 204 357.749 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 207 70.7002 ==> SRR5423466.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 86 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423466 completed mapping pipeline successfully