Starting /dee2/code/volunteer_pipeline.sh SRR5423467 current disk space = 3051548647424 free memory = 1505278112 SRR5423467 SRAfilesize 402191415a6ca98a7dc9ce9fdb015fe1 SRR5423467.sra SRR5423467.sra file validated SRR5423467 is single end SRR5423467 is conventional basespace SRR5423467 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423467_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3345 34.0 31.0 34.0 30.0 34.0 2 32.435 34.0 31.0 34.0 30.0 34.0 3 32.51525 34.0 31.0 34.0 30.0 34.0 4 35.78 37.0 35.0 37.0 33.0 37.0 5 35.88925 37.0 35.0 37.0 35.0 37.0 6 35.85325 37.0 35.0 37.0 35.0 37.0 7 35.948 37.0 35.0 37.0 35.0 37.0 8 36.017 37.0 35.0 37.0 35.0 37.0 9 37.57225 39.0 37.0 39.0 35.0 39.0 10 37.532 39.0 37.0 39.0 35.0 39.0 11 37.48725 39.0 37.0 39.0 35.0 39.0 12 37.5625 39.0 37.0 39.0 35.0 39.0 13 37.516 39.0 37.0 39.0 35.0 39.0 14 38.63825 40.0 38.0 41.0 34.0 41.0 15 38.86225 40.0 38.0 41.0 35.0 41.0 16 38.90525 40.0 38.0 41.0 35.0 41.0 17 38.90025 40.0 38.0 41.0 36.0 41.0 18 38.89025 40.0 38.0 41.0 35.0 41.0 19 38.871 40.0 38.0 41.0 35.0 41.0 20 38.928 40.0 38.0 41.0 36.0 41.0 21 38.78625 40.0 38.0 41.0 35.0 41.0 22 38.81125 40.0 38.0 41.0 34.0 41.0 23 38.8935 40.0 38.0 41.0 35.0 41.0 24 38.8235 40.0 38.0 41.0 35.0 41.0 25 38.67525 40.0 38.0 41.0 34.0 41.0 26 38.79775 40.0 38.0 41.0 35.0 41.0 27 38.69775 40.0 38.0 41.0 35.0 41.0 28 38.6285 40.0 38.0 41.0 34.0 41.0 29 38.712 40.0 38.0 41.0 35.0 41.0 30 38.5975 40.0 38.0 41.0 34.0 41.0 31 38.41225 40.0 38.0 41.0 34.0 41.0 32 38.53275 40.0 38.0 41.0 34.0 41.0 33 38.497 40.0 38.0 41.0 34.0 41.0 34 38.59525 40.0 38.0 41.0 34.0 41.0 35 38.47 40.0 38.0 41.0 34.0 41.0 36 38.39875 40.0 38.0 41.0 34.0 41.0 37 38.328 40.0 38.0 41.0 34.0 41.0 38 38.38 40.0 38.0 41.0 34.0 41.0 39 38.38675 40.0 38.0 41.0 34.0 41.0 40 38.16675 40.0 38.0 41.0 33.0 41.0 41 38.18925 40.0 38.0 41.0 33.0 41.0 42 38.064 40.0 38.0 41.0 33.0 41.0 43 38.065 40.0 38.0 41.0 33.0 41.0 44 37.9695 40.0 37.0 41.0 33.0 41.0 45 37.7545 40.0 37.0 41.0 32.0 41.0 46 37.718 40.0 37.0 41.0 32.0 41.0 47 37.523 40.0 37.0 41.0 32.0 41.0 48 37.52475 40.0 37.0 41.0 32.0 41.0 49 37.81125 40.0 37.0 41.0 33.0 41.0 50 37.5995 40.0 37.0 41.0 32.0 41.0 51 37.516 40.0 37.0 41.0 32.0 41.0 52 36.5655 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2108 1 0.0 2108 2 0.0 2108 3 0.0 2108 4 0.0 2108 5 0.0 2108 6 0.0 2108 7 0.0 2108 8 0.0 2108 9 0.0 2108 10 0.0 2108 11 0.0 2108 12 0.0 2108 13 0.0 2108 14 0.0 2108 15 0.0 2108 16 0.0 2108 17 0.0 2108 18 0.0 2108 19 0.0 2108 20 0.0 2108 21 0.0 2108 22 0.0 2108 23 0.0 2108 24 0.0 2108 25 0.0 2108 26 0.0 2108 27 0.0 2108 28 0.0 2108 29 0.0 2108 30 0.0 2108 31 0.0 2108 32 0.0 2108 33 0.0 2108 34 0.0 2108 35 0.0 2108 36 0.0 2108 37 0.0 2108 38 0.0 2108 39 0.0 2108 40 0.0 2108 41 0.0 2108 42 0.0 2108 43 0.0 2108 44 0.0 2108 45 0.0 2108 46 0.0 2108 47 0.0 2108 48 0.0 2108 49 0.0 2108 50 0.0 2108 51 0.0 2108 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 0.0 22 1.0 23 0.0 24 8.0 25 8.0 26 14.0 27 14.0 28 20.0 29 33.0 30 44.0 31 68.0 32 78.0 33 115.0 34 143.0 35 196.0 36 276.0 37 424.0 38 789.0 39 1757.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.919879819729594 10.891337005508262 9.01352028042063 50.17526289434151 2 20.65 16.5 38.5 24.349999999999998 3 20.150000000000002 19.25 26.525 34.075 4 24.375 28.849999999999998 21.05 25.724999999999998 5 24.55 31.025000000000002 25.15 19.275000000000002 6 18.45 31.25 26.650000000000002 23.65 7 16.325 22.0 40.825 20.849999999999998 8 20.25 21.05 29.475 29.225 9 19.975 19.825 33.825 26.375 10 20.075000000000003 35.8 23.150000000000002 20.974999999999998 11 24.75 24.8 21.6 28.849999999999998 12 22.625 21.95 26.85 28.575 13 21.0 24.75 28.125 26.125 14 20.974999999999998 24.775 28.349999999999998 25.900000000000002 15 20.925 24.775 27.725 26.575 16 21.85 25.95 26.5 25.7 17 22.275 25.25 26.275 26.200000000000003 18 20.7 25.75 26.75 26.8 19 22.95 24.85 25.775 26.424999999999997 20 21.099999999999998 26.125 26.650000000000002 26.125 21 21.6 24.05 28.349999999999998 26.0 22 22.025 24.5 27.900000000000002 25.575 23 22.575 24.75 26.400000000000002 26.275 24 21.75 23.549999999999997 27.175 27.525 25 22.25 25.4 25.825 26.525 26 21.73043260815204 26.506626656664167 26.456614153538382 25.30632658164541 27 22.2 24.55 26.150000000000002 27.1 28 22.325 24.925 25.974999999999998 26.775 29 22.55 26.275 25.775 25.4 30 21.575 25.45 26.674999999999997 26.3 31 21.65 26.474999999999998 26.325 25.55 32 23.175 24.15 26.25 26.424999999999997 33 22.525000000000002 22.725 28.749999999999996 26.0 34 22.15 23.674999999999997 26.8 27.375 35 23.1 24.725 26.325 25.85 36 21.4 26.150000000000002 25.674999999999997 26.775 37 21.65 24.975 26.700000000000003 26.674999999999997 38 22.8 24.8 27.175 25.224999999999998 39 22.025 24.05 26.150000000000002 27.775 40 21.25 25.75 26.35 26.650000000000002 41 22.525000000000002 25.5 26.174999999999997 25.8 42 22.1 23.825 27.400000000000002 26.674999999999997 43 21.9 24.5 26.35 27.250000000000004 44 22.075 25.45 26.75 25.724999999999998 45 22.88072018004501 24.55613903475869 25.85646411602901 26.70667666916729 46 22.43060765191298 25.406351587896975 26.556639159789945 25.6064016004001 47 22.511255627813906 25.83791895947974 25.71285642821411 25.937968984492244 48 21.866399799849887 25.344008006004504 25.544158118588946 27.24543407555667 49 21.580395098774694 24.656164041010253 26.25656414103526 27.506876719179797 50 22.630657664416105 23.50587646911728 26.206551637909474 27.656914228557138 51 22.305576394098527 23.030757689422355 26.981745436359088 27.68192048012003 52 21.2 26.0 25.75 27.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 2.0 21 2.0 22 5.0 23 8.0 24 9.0 25 10.0 26 13.5 27 17.0 28 21.5 29 26.0 30 30.0 31 34.0 32 47.0 33 60.0 34 71.0 35 82.0 36 94.5 37 107.0 38 130.0 39 188.0 40 223.0 41 229.0 42 235.0 43 266.5 44 298.0 45 318.5 46 339.0 47 364.0 48 389.0 49 392.5 50 396.0 51 409.5 52 423.0 53 374.5 54 326.0 55 302.5 56 279.0 57 235.0 58 191.0 59 172.5 60 154.0 61 128.0 62 102.0 63 72.5 64 42.5 65 42.0 66 31.0 67 20.0 68 19.0 69 18.0 70 12.5 71 7.0 72 6.0 73 5.0 74 4.5 75 4.0 76 3.5 77 3.0 78 1.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.025 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.025 46 0.025 47 0.05 48 0.075 49 0.025 50 0.025 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01490275322051 98.0 2 0.9345794392523363 1.8499999999999999 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra Read 200000 spots for SRR5423467.sra Written 200000 spots for SRR5423467.sra SRR ids: ['SRR5423467.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v634cq2y SRR5423467.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423467 file size 703977 SRR5423467 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423467 SRR5423467_1.fastq Input file: SRR5423467_1.fastq trimmed: SRR5423467-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:32:22 2025 >> started Wed Feb 12 15:32:24 2025 >> done (1.633s) 4000000 reads processed; of these: 173 ( 0.00%) short reads filtered out after trimming by size control 206 ( 0.01%) empty reads filtered out after trimming by size control 3999621 (99.99%) reads available; of these: 59728 ( 1.49%) trimmed reads available after processing 3939893 (98.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 4 0.00% 21 2 0.00% 22 0 0.00% 23 2 0.00% 24 3 0.00% 25 5 0.00% 26 2 0.00% 27 5 0.00% 28 7 0.00% 29 8 0.00% 30 3 0.00% 31 13 0.00% 32 9 0.00% 33 15 0.00% 34 19 0.00% 35 18 0.00% 36 22 0.00% 37 29 0.00% 38 42 0.00% 39 47 0.00% 40 52 0.00% 41 53 0.00% 42 75 0.00% 43 134 0.00% 44 203 0.01% 45 254 0.01% 46 410 0.01% 47 591 0.01% 48 947 0.02% 49 2213 0.06% 50 6876 0.17% 51 47650 1.19% 52 3939893 98.51% 3999621 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=28 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=8 fanout-score=159.49 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=20.5 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:32:44 Started mapping on | Feb 12 15:32:44 Finished on | Feb 12 15:32:50 Mapping speed, Million of reads per hour | 2399.77 Number of input reads | 3999621 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3596111 Uniquely mapped reads % | 89.91% Average mapped length | 51.85 Number of splices: Total | 474220 Number of splices: Annotated (sjdb) | 468981 Number of splices: GT/AG | 465590 Number of splices: GC/AG | 7693 Number of splices: AT/AC | 368 Number of splices: Non-canonical | 569 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316907 % of reads mapped to multiple loci | 7.92% Number of reads mapped to too many loci | 72913 % of reads mapped to too many loci | 1.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 86603 86603 86603 N_multimapping 316907 316907 316907 N_noFeature 105346 3564267 117670 N_ambiguous 33650 57 14087 UnstrandedReadsAssigned:3457115 PositiveStrandReadsAssigned:31787 NegativeStrandReadsAssigned:3464354 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423467 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423467-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,621 reads, 3,685,581 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52401 SRR5423467.ke.tsv 34699 SRR5423467.se.tsv 87100 total ==> SRR5423467.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 66 10.3494 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 7 2.44365 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 71.0139 7.51384 Potri.016G087400.1.v4.1 270 171 181 318.516 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.17976 Potri.012G127500.1.v4.1 977 878 189 64.7762 ==> SRR5423467.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 88 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423467 completed mapping pipeline successfully