Starting /dee2/code/volunteer_pipeline.sh SRR5423468 current disk space = 3051723857920 free memory = 1513405672 SRR5423468 SRAfilesize bda5d451c7bc37168d562544c36b10bf SRR5423468.sra SRR5423468.sra file validated SRR5423468 is single end SRR5423468 is conventional basespace SRR5423468 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423468_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8095 34.0 31.0 34.0 31.0 34.0 2 32.9785 34.0 31.0 34.0 31.0 34.0 3 32.99375 34.0 33.0 34.0 31.0 34.0 4 36.2925 37.0 37.0 37.0 35.0 37.0 5 36.25675 37.0 37.0 37.0 35.0 37.0 6 36.255 37.0 37.0 37.0 35.0 37.0 7 36.2975 37.0 37.0 37.0 35.0 37.0 8 36.29075 37.0 37.0 37.0 35.0 37.0 9 38.025 39.0 38.0 39.0 37.0 39.0 10 38.0235 39.0 38.0 39.0 35.0 39.0 11 37.91 39.0 38.0 39.0 35.0 39.0 12 37.97525 39.0 38.0 39.0 35.0 39.0 13 37.8955 39.0 38.0 39.0 35.0 39.0 14 39.35775 41.0 39.0 41.0 36.0 41.0 15 39.49425 41.0 39.0 41.0 37.0 41.0 16 39.4955 41.0 39.0 41.0 37.0 41.0 17 39.4035 41.0 39.0 41.0 36.0 41.0 18 39.368 41.0 39.0 41.0 36.0 41.0 19 39.392 41.0 39.0 41.0 37.0 41.0 20 39.37 41.0 39.0 41.0 36.0 41.0 21 39.45575 41.0 39.0 41.0 37.0 41.0 22 39.369 41.0 39.0 41.0 37.0 41.0 23 39.331 41.0 39.0 41.0 36.0 41.0 24 39.30475 41.0 39.0 41.0 36.0 41.0 25 39.2545 41.0 39.0 41.0 36.0 41.0 26 39.305 41.0 39.0 41.0 36.0 41.0 27 39.146 40.0 39.0 41.0 36.0 41.0 28 39.22025 41.0 39.0 41.0 36.0 41.0 29 39.13025 41.0 39.0 41.0 36.0 41.0 30 39.18875 41.0 39.0 41.0 36.0 41.0 31 39.22575 40.0 39.0 41.0 36.0 41.0 32 39.16725 40.0 39.0 41.0 36.0 41.0 33 38.99575 40.0 39.0 41.0 35.0 41.0 34 38.95025 40.0 39.0 41.0 35.0 41.0 35 38.9 40.0 39.0 41.0 35.0 41.0 36 38.81425 40.0 38.0 41.0 35.0 41.0 37 38.75175 40.0 38.0 41.0 35.0 41.0 38 38.647 40.0 38.0 41.0 35.0 41.0 39 38.60325 40.0 38.0 41.0 34.0 41.0 40 38.64225 40.0 38.0 41.0 34.0 41.0 41 38.5695 40.0 38.0 41.0 34.0 41.0 42 38.6295 40.0 38.0 41.0 34.0 41.0 43 38.40825 40.0 38.0 41.0 34.0 41.0 44 38.307 40.0 38.0 41.0 34.0 41.0 45 38.31025 40.0 38.0 41.0 34.0 41.0 46 38.0925 40.0 38.0 41.0 33.0 41.0 47 38.201 40.0 38.0 41.0 33.0 41.0 48 38.235 40.0 38.0 41.0 34.0 41.0 49 38.0515 40.0 38.0 41.0 33.0 41.0 50 38.043 40.0 37.0 41.0 33.0 41.0 51 37.974 40.0 37.0 41.0 33.0 41.0 52 36.676 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10 0.0 2203 11 0.0 2203 12 0.0 2203 13 0.0 2203 14 0.0 2203 15 0.0 2203 16 0.0 2203 17 0.0 2203 18 0.0 2203 19 0.0 2203 20 0.0 2203 21 0.0 2203 22 0.0 2203 23 0.0 2203 24 0.0 2203 25 0.0 2203 26 0.0 2203 27 0.0 2203 28 0.0 2203 29 0.0 2203 30 0.0 2203 31 0.0 2203 32 0.0 2203 33 0.0 2203 34 0.0 2203 35 0.0 2203 36 0.0 2203 37 0.0 2203 38 0.0 2203 39 0.0 2203 40 0.0 2203 41 0.0 2203 42 0.0 2203 43 0.0 2203 44 0.0 2203 45 0.0 2203 46 0.0 2203 47 0.0 2203 48 0.0 2203 49 0.0 2203 50 0.0 2203 51 0.0 2203 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 3.0 23 2.0 24 5.0 25 7.0 26 8.0 27 13.0 28 16.0 29 24.0 30 27.0 31 45.0 32 55.0 33 76.0 34 103.0 35 132.0 36 225.0 37 339.0 38 685.0 39 2216.0 40 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.177811169546708 11.094415226646632 9.316303531179564 49.4114700726271 2 20.849999999999998 15.475 38.5 25.174999999999997 3 20.45 19.5 25.324999999999996 34.725 4 24.0 29.075 21.625 25.3 5 21.5 32.75 25.474999999999998 20.275000000000002 6 18.35 32.1 26.0 23.549999999999997 7 15.15 23.1 42.35 19.400000000000002 8 18.975 20.599999999999998 31.374999999999996 29.049999999999997 9 18.5 20.575 32.2 28.725 10 18.125 36.225 24.099999999999998 21.55 11 24.25 25.900000000000002 22.175 27.675 12 21.775 20.825 27.05 30.349999999999998 13 20.225 23.65 27.725 28.4 14 20.0 25.474999999999998 29.125 25.4 15 20.7 25.324999999999996 28.249999999999996 25.724999999999998 16 22.125 25.15 26.25 26.474999999999998 17 22.05 25.424999999999997 26.224999999999998 26.3 18 20.625 26.025 26.6 26.75 19 21.075 26.6 26.3 26.025 20 21.175 26.450000000000003 26.174999999999997 26.200000000000003 21 21.275 25.35 26.474999999999998 26.900000000000002 22 20.724999999999998 26.05 27.875 25.35 23 20.474999999999998 26.025 27.375 26.125 24 21.25 24.65 26.224999999999998 27.875 25 21.95 25.474999999999998 26.75 25.825 26 21.224999999999998 24.55 26.650000000000002 27.575 27 20.625 25.324999999999996 27.425 26.625 28 22.2 24.95 25.05 27.800000000000004 29 19.400000000000002 27.750000000000004 27.075 25.775 30 21.025 24.6 26.700000000000003 27.675 31 20.65 26.1 26.3 26.950000000000003 32 22.1 25.6 26.700000000000003 25.6 33 21.075 24.625 26.75 27.55 34 21.575 24.925 27.025 26.474999999999998 35 22.85 24.75 27.0 25.4 36 21.725 24.125 25.15 28.999999999999996 37 20.724999999999998 26.650000000000002 25.3 27.325 38 22.625 25.05 26.674999999999997 25.650000000000002 39 21.575 25.0 26.325 27.1 40 21.625 26.125 25.624999999999996 26.625 41 22.400000000000002 24.275 28.1 25.224999999999998 42 21.75 24.5 26.974999999999998 26.775 43 22.05 25.525 25.025 27.400000000000002 44 21.825 25.074999999999996 26.674999999999997 26.424999999999997 45 22.15 23.7 26.325 27.825 46 21.099999999999998 25.374999999999996 25.85 27.675 47 22.775000000000002 24.175 25.6 27.450000000000003 48 21.65 24.975 25.650000000000002 27.725 49 22.275 24.75 26.0 26.974999999999998 50 22.0 23.95 26.75 27.3 51 21.925 24.15 25.624999999999996 28.299999999999997 52 21.8 25.2 26.375 26.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 2.5 21 3.0 22 2.5 23 2.0 24 7.5 25 13.0 26 13.0 27 13.0 28 17.5 29 22.0 30 38.0 31 54.0 32 56.0 33 58.0 34 75.5 35 93.0 36 104.5 37 116.0 38 133.0 39 185.0 40 220.0 41 232.0 42 244.0 43 278.5 44 313.0 45 333.5 46 354.0 47 376.5 48 399.0 49 399.5 50 400.0 51 400.0 52 400.0 53 366.5 54 333.0 55 296.0 56 259.0 57 222.0 58 185.0 59 154.5 60 124.0 61 108.0 62 92.0 63 74.0 64 47.5 65 39.0 66 30.0 67 21.0 68 17.0 69 13.0 70 8.5 71 4.0 72 6.5 73 9.0 74 7.5 75 6.0 76 4.0 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra Read 200000 spots for SRR5423468.sra Written 200000 spots for SRR5423468.sra SRR ids: ['SRR5423468.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oeaofv0y SRR5423468.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423468 file size 703946 SRR5423468 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423468 SRR5423468_1.fastq Input file: SRR5423468_1.fastq trimmed: SRR5423468-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:48:41 2025 >> started Wed Feb 12 15:48:42 2025 >> done (1.836s) 4000000 reads processed; of these: 141 ( 0.00%) short reads filtered out after trimming by size control 215 ( 0.01%) empty reads filtered out after trimming by size control 3999644 (99.99%) reads available; of these: 57833 ( 1.45%) trimmed reads available after processing 3941811 (98.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 6 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 6 0.00% 26 4 0.00% 27 7 0.00% 28 9 0.00% 29 3 0.00% 30 7 0.00% 31 8 0.00% 32 12 0.00% 33 18 0.00% 34 17 0.00% 35 21 0.00% 36 29 0.00% 37 30 0.00% 38 29 0.00% 39 37 0.00% 40 60 0.00% 41 84 0.00% 42 86 0.00% 43 114 0.00% 44 161 0.00% 45 247 0.01% 46 431 0.01% 47 625 0.02% 48 1034 0.03% 49 2291 0.06% 50 6575 0.16% 51 45872 1.15% 52 3941811 98.55% 3999644 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=63.94 fanout-score-rank=4 prefix-density=0.50 prefix-fanout=13.1 sequence=CTTCTTCTCCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=9 fanout-score=164.52 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=20.2 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:48:53 Started mapping on | Feb 12 15:48:53 Finished on | Feb 12 15:48:58 Mapping speed, Million of reads per hour | 2879.74 Number of input reads | 3999644 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3595888 Uniquely mapped reads % | 89.91% Average mapped length | 51.85 Number of splices: Total | 472872 Number of splices: Annotated (sjdb) | 467769 Number of splices: GT/AG | 464145 Number of splices: GC/AG | 7794 Number of splices: AT/AC | 365 Number of splices: Non-canonical | 568 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317778 % of reads mapped to multiple loci | 7.95% Number of reads mapped to too many loci | 72461 % of reads mapped to too many loci | 1.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.33% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 85978 85978 85978 N_multimapping 317778 317778 317778 N_noFeature 104378 3563984 116883 N_ambiguous 33495 61 14054 UnstrandedReadsAssigned:3458015 PositiveStrandReadsAssigned:31843 NegativeStrandReadsAssigned:3464951 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423468 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423468-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,644 reads, 3,702,497 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR5423468.ke.tsv 34699 SRR5423468.se.tsv 87100 total ==> SRR5423468.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 60 9.3669 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 13 4.5181 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 51.4952 5.42446 Potri.016G087400.1.v4.1 270 171 210 367.911 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.178963 Potri.012G127500.1.v4.1 977 878 192 65.5128 ==> SRR5423468.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 79 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423468 completed mapping pipeline successfully