Starting /dee2/code/volunteer_pipeline.sh SRR5423469 current disk space = 3051725189120 free memory = 1576910652 SRR5423469 SRAfilesize 8cc775d1b4a69a23d5284ef07f304661 SRR5423469.sra SRR5423469.sra file validated SRR5423469 is single end SRR5423469 is conventional basespace SRR5423469 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423469_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.52075 31.0 31.0 34.0 28.0 34.0 2 31.94975 33.0 31.0 34.0 30.0 34.0 3 32.19075 34.0 31.0 34.0 30.0 34.0 4 32.5015 35.0 32.0 37.0 19.0 37.0 5 34.6705 35.0 35.0 37.0 30.0 37.0 6 35.24225 37.0 35.0 37.0 32.0 37.0 7 35.3765 37.0 35.0 37.0 33.0 37.0 8 35.5905 37.0 35.0 37.0 33.0 37.0 9 37.27725 39.0 37.0 39.0 34.0 39.0 10 37.19325 39.0 37.0 39.0 33.0 39.0 11 37.1875 39.0 37.0 39.0 33.0 39.0 12 37.28225 39.0 37.0 39.0 34.0 39.0 13 37.2645 39.0 37.0 39.0 34.0 39.0 14 38.5245 40.0 38.0 41.0 34.0 41.0 15 38.609 40.0 38.0 41.0 34.0 41.0 16 38.3685 40.0 38.0 41.0 33.0 41.0 17 38.58925 40.0 38.0 41.0 34.0 41.0 18 38.61825 40.0 38.0 41.0 34.0 41.0 19 38.57275 40.0 38.0 41.0 34.0 41.0 20 38.53775 40.0 38.0 41.0 34.0 41.0 21 38.5035 40.0 38.0 41.0 34.0 41.0 22 38.466 40.0 38.0 41.0 34.0 41.0 23 38.486 40.0 38.0 41.0 34.0 41.0 24 38.5825 40.0 38.0 41.0 34.0 41.0 25 38.589 40.0 38.0 41.0 34.0 41.0 26 38.34425 40.0 38.0 41.0 34.0 41.0 27 38.286 40.0 38.0 41.0 34.0 41.0 28 38.4285 40.0 38.0 41.0 34.0 41.0 29 38.3275 40.0 38.0 41.0 34.0 41.0 30 38.44325 40.0 38.0 41.0 34.0 41.0 31 38.343 40.0 38.0 41.0 34.0 41.0 32 38.45425 40.0 38.0 41.0 34.0 41.0 33 38.44525 40.0 38.0 41.0 34.0 41.0 34 38.2305 40.0 38.0 41.0 33.0 41.0 35 38.244 40.0 38.0 41.0 34.0 41.0 36 38.26 40.0 38.0 41.0 34.0 41.0 37 38.0515 40.0 38.0 41.0 33.0 41.0 38 37.90025 40.0 37.0 41.0 33.0 41.0 39 38.043 40.0 37.0 41.0 33.0 41.0 40 37.8685 40.0 37.0 41.0 33.0 41.0 41 37.81175 40.0 37.0 41.0 32.0 41.0 42 37.8755 40.0 37.0 41.0 33.0 41.0 43 37.7745 40.0 37.0 41.0 32.0 41.0 44 37.45375 40.0 37.0 41.0 32.0 41.0 45 37.58825 40.0 37.0 41.0 32.0 41.0 46 37.55875 40.0 37.0 41.0 32.0 41.0 47 37.43225 40.0 36.0 41.0 32.0 41.0 48 37.3645 40.0 36.0 41.0 31.0 41.0 49 37.32075 39.0 36.0 41.0 31.0 41.0 50 37.1225 39.0 36.0 41.0 31.0 41.0 51 37.17175 39.0 36.0 41.0 31.0 41.0 52 36.49525 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2214 1 0.0 2214 2 0.0 2214 3 0.0 2214 4 0.0 2214 5 0.0 2214 6 0.0 2214 7 0.0 2214 8 0.0 2214 9 0.0 2214 10 0.0 2214 11 0.0 2214 12 0.0 2214 13 0.0 2214 14 0.0 2214 15 0.0 2214 16 0.0 2214 17 0.0 2214 18 0.0 2214 19 0.0 2214 20 0.0 2214 21 0.0 2214 22 0.0 2214 23 0.0 2214 24 0.0 2214 25 0.0 2214 26 0.0 2214 27 0.0 2214 28 0.0 2214 29 0.0 2214 30 0.0 2214 31 0.0 2214 32 0.0 2214 33 0.0 2214 34 0.0 2214 35 0.0 2214 36 0.0 2214 37 0.0 2214 38 0.0 2214 39 0.0 2214 40 0.0 2214 41 0.0 2214 42 0.0 2214 43 0.0 2214 44 0.0 2214 45 0.0 2214 46 0.0 2214 47 0.0 2214 48 0.0 2214 49 0.0 2214 50 0.0 2214 51 0.0 2214 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 2.0 24 2.0 25 11.0 26 14.0 27 23.0 28 27.0 29 48.0 30 47.0 31 87.0 32 108.0 33 119.0 34 172.0 35 269.0 36 325.0 37 480.0 38 826.0 39 1429.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.457364341085274 10.777694423605903 9.30232558139535 50.46261565391348 2 20.225 16.825000000000003 38.224999999999994 24.725 3 20.474999999999998 19.025 24.65 35.85 4 23.25 26.900000000000002 24.275 25.575 5 21.85 32.425 24.4 21.325 6 18.275 33.225 25.624999999999996 22.875 7 16.625 21.575 41.05 20.75 8 18.85 20.549999999999997 30.775000000000002 29.825000000000003 9 18.575 19.8 32.475 29.15 10 19.3 36.7 24.15 19.85 11 25.15 24.224999999999998 22.2 28.425 12 22.125 22.75 26.400000000000002 28.725 13 20.95 24.075 27.700000000000003 27.275 14 19.775000000000002 25.4 27.325 27.500000000000004 15 20.05 26.974999999999998 26.325 26.650000000000002 16 20.95 26.724999999999998 26.150000000000002 26.174999999999997 17 20.825 26.950000000000003 26.375 25.85 18 21.075 25.724999999999998 27.625 25.575 19 22.075 24.9 25.6 27.425 20 21.375 25.874999999999996 26.724999999999998 26.025 21 20.65 24.85 27.375 27.125 22 21.125 25.974999999999998 26.474999999999998 26.424999999999997 23 21.3 25.650000000000002 26.275 26.775 24 21.825 25.124999999999996 25.825 27.224999999999998 25 21.575 25.7 25.374999999999996 27.35 26 21.3 26.275 26.674999999999997 25.75 27 22.7 24.525 26.174999999999997 26.6 28 21.95 25.8 25.45 26.8 29 20.825 25.8 26.924999999999997 26.450000000000003 30 21.25 24.65 26.8 27.3 31 20.825 25.624999999999996 26.650000000000002 26.900000000000002 32 22.075 25.95 25.724999999999998 26.25 33 22.875 24.3 27.275 25.55 34 21.875 25.85 25.124999999999996 27.150000000000002 35 20.875 25.174999999999997 25.974999999999998 27.975 36 21.45 24.125 26.05 28.375 37 21.15 24.975 27.375 26.5 38 22.275 25.4 25.724999999999998 26.6 39 22.725 24.95 25.95 26.375 40 21.525 24.65 27.400000000000002 26.424999999999997 41 21.925 24.775 26.150000000000002 27.150000000000002 42 21.725 25.8 25.575 26.900000000000002 43 21.875 26.55 25.75 25.825 44 22.275 25.224999999999998 28.075 24.425 45 22.475 23.525 26.8 27.200000000000003 46 21.825 24.6 26.325 27.250000000000004 47 21.075 25.074999999999996 26.525 27.325 48 21.925 25.15 26.25 26.674999999999997 49 21.925 24.125 26.650000000000002 27.3 50 23.55588897224306 25.006251562890725 25.656414103525883 25.78144536134033 51 22.025 23.375 26.825 27.775 52 22.425 24.4 25.35 27.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.5 19 5.0 20 5.5 21 6.0 22 6.0 23 6.0 24 7.0 25 8.0 26 12.0 27 16.0 28 22.5 29 29.0 30 40.0 31 51.0 32 57.0 33 63.0 34 66.5 35 70.0 36 91.5 37 113.0 38 129.5 39 174.5 40 203.0 41 228.0 42 253.0 43 280.0 44 307.0 45 345.5 46 384.0 47 390.5 48 397.0 49 382.0 50 367.0 51 367.5 52 368.0 53 363.0 54 358.0 55 301.5 56 245.0 57 224.5 58 204.0 59 170.5 60 137.0 61 116.0 62 95.0 63 83.0 64 54.0 65 37.0 66 29.5 67 22.0 68 21.5 69 21.0 70 12.0 71 3.0 72 6.0 73 9.0 74 6.5 75 4.0 76 2.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra Read 200000 spots for SRR5423469.sra Written 200000 spots for SRR5423469.sra SRR ids: ['SRR5423469.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t2n2ppnl SRR5423469.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423469 file size 703990 SRR5423469 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423469 SRR5423469_1.fastq Input file: SRR5423469_1.fastq trimmed: SRR5423469-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:49:07 2025 >> started Wed Feb 12 15:49:09 2025 >> done (2.069s) 4000000 reads processed; of these: 154 ( 0.00%) short reads filtered out after trimming by size control 213 ( 0.01%) empty reads filtered out after trimming by size control 3999633 (99.99%) reads available; of these: 58041 ( 1.45%) trimmed reads available after processing 3941592 (98.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 9 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 4 0.00% 27 6 0.00% 28 5 0.00% 29 4 0.00% 30 7 0.00% 31 11 0.00% 32 20 0.00% 33 14 0.00% 34 21 0.00% 35 19 0.00% 36 31 0.00% 37 25 0.00% 38 36 0.00% 39 38 0.00% 40 64 0.00% 41 78 0.00% 42 109 0.00% 43 138 0.00% 44 190 0.00% 45 294 0.01% 46 444 0.01% 47 634 0.02% 48 1093 0.03% 49 2267 0.06% 50 6527 0.16% 51 45932 1.15% 52 3941592 98.55% 3999633 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=27 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=160.57 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=20.2 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:49:21 Started mapping on | Feb 12 15:49:21 Finished on | Feb 12 15:49:26 Mapping speed, Million of reads per hour | 2879.74 Number of input reads | 3999633 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3595615 Uniquely mapped reads % | 89.90% Average mapped length | 51.85 Number of splices: Total | 473056 Number of splices: Annotated (sjdb) | 467801 Number of splices: GT/AG | 464430 Number of splices: GC/AG | 7699 Number of splices: AT/AC | 341 Number of splices: Non-canonical | 586 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317690 % of reads mapped to multiple loci | 7.94% Number of reads mapped to too many loci | 72546 % of reads mapped to too many loci | 1.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 86328 86328 86328 N_multimapping 317690 317690 317690 N_noFeature 104613 3563681 117026 N_ambiguous 33749 67 14181 UnstrandedReadsAssigned:3457253 PositiveStrandReadsAssigned:31867 NegativeStrandReadsAssigned:3464408 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423469 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423469-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,633 reads, 3,702,989 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR5423469.ke.tsv 34699 SRR5423469.se.tsv 87100 total ==> SRR5423469.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 56 8.75094 Potri.005G024800.1.v4.1 1035 936 1 0.32038 Potri.004G059700.1.v4.1 961 862 11 3.82672 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 59.5521 6.27927 Potri.016G087400.1.v4.1 270 171 166 291.108 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.179137 Potri.012G127500.1.v4.1 977 878 199 67.9673 ==> SRR5423469.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 83 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423469 completed mapping pipeline successfully