Starting /dee2/code/volunteer_pipeline.sh SRR5423470 current disk space = 3051709530112 free memory = 1499506772 SRR5423470 SRAfilesize e5fd889a67cbd97f9b7d215ab025c63b SRR5423470.sra SRR5423470.sra file validated SRR5423470 is single end SRR5423470 is conventional basespace SRR5423470 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423470_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2135 34.0 31.0 34.0 30.0 34.0 2 32.4065 34.0 31.0 34.0 30.0 34.0 3 32.471 34.0 31.0 34.0 30.0 34.0 4 35.42325 37.0 35.0 37.0 33.0 37.0 5 35.741 37.0 35.0 37.0 33.0 37.0 6 35.79725 37.0 35.0 37.0 35.0 37.0 7 35.859 37.0 35.0 37.0 35.0 37.0 8 35.95425 37.0 35.0 37.0 35.0 37.0 9 37.62975 39.0 37.0 39.0 35.0 39.0 10 37.5005 39.0 37.0 39.0 35.0 39.0 11 37.63 39.0 37.0 39.0 35.0 39.0 12 37.491 39.0 37.0 39.0 35.0 39.0 13 37.56975 39.0 37.0 39.0 35.0 39.0 14 38.91225 40.0 38.0 41.0 35.0 41.0 15 38.7905 40.0 38.0 41.0 35.0 41.0 16 38.74125 40.0 38.0 41.0 34.0 41.0 17 38.8125 40.0 38.0 41.0 35.0 41.0 18 38.812 40.0 38.0 41.0 35.0 41.0 19 38.73525 40.0 38.0 41.0 34.0 41.0 20 38.7595 40.0 38.0 41.0 34.0 41.0 21 38.8325 40.0 38.0 41.0 35.0 41.0 22 38.67975 40.0 38.0 41.0 34.0 41.0 23 38.76575 40.0 38.0 41.0 34.0 41.0 24 38.7715 40.0 38.0 41.0 34.0 41.0 25 38.793 40.0 38.0 41.0 35.0 41.0 26 38.7425 40.0 38.0 41.0 35.0 41.0 27 38.71575 40.0 38.0 41.0 34.0 41.0 28 38.70475 40.0 38.0 41.0 35.0 41.0 29 38.62025 40.0 38.0 41.0 34.0 41.0 30 38.2275 40.0 38.0 41.0 33.0 41.0 31 38.43775 40.0 38.0 41.0 34.0 41.0 32 38.46125 40.0 38.0 41.0 34.0 41.0 33 38.432 40.0 38.0 41.0 34.0 41.0 34 38.51525 40.0 38.0 41.0 34.0 41.0 35 38.3385 40.0 38.0 41.0 34.0 41.0 36 38.40025 40.0 38.0 41.0 34.0 41.0 37 38.384 40.0 38.0 41.0 34.0 41.0 38 38.31 40.0 38.0 41.0 34.0 41.0 39 38.32675 40.0 38.0 41.0 34.0 41.0 40 38.37075 40.0 38.0 41.0 34.0 41.0 41 38.214 40.0 38.0 41.0 33.0 41.0 42 38.12875 40.0 38.0 41.0 33.0 41.0 43 37.8195 40.0 37.0 41.0 33.0 41.0 44 37.9795 40.0 37.0 41.0 33.0 41.0 45 37.837 40.0 37.0 41.0 33.0 41.0 46 37.87625 40.0 37.0 41.0 33.0 41.0 47 37.812 40.0 37.0 41.0 33.0 41.0 48 37.578 40.0 37.0 41.0 32.0 41.0 49 37.49825 40.0 37.0 41.0 32.0 41.0 50 37.45975 40.0 36.0 41.0 32.0 41.0 51 37.5935 40.0 37.0 41.0 32.0 41.0 52 36.5105 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10 0.0 2309 11 0.0 2309 12 0.0 2309 13 0.0 2309 14 0.0 2309 15 0.0 2309 16 0.0 2309 17 0.0 2309 18 0.0 2309 19 0.0 2309 20 0.0 2309 21 0.0 2309 22 0.0 2309 23 0.0 2309 24 0.0 2309 25 0.0 2309 26 0.0 2309 27 0.0 2309 28 0.0 2309 29 0.0 2309 30 0.0 2309 31 0.0 2309 32 0.0 2309 33 0.0 2309 34 0.0 2309 35 0.0 2309 36 0.0 2309 37 0.0 2309 38 0.0 2309 39 0.0 2309 40 0.0 2309 41 0.0 2309 42 0.0 2309 43 0.0 2309 44 0.0 2309 45 0.0 2309 46 0.0 2309 47 0.0 2309 48 0.0 2309 49 0.0 2309 50 0.0 2309 51 0.0 2309 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 2.0 24 8.0 25 5.0 26 12.0 27 18.0 28 31.0 29 30.0 30 55.0 31 60.0 32 90.0 33 115.0 34 125.0 35 192.0 36 272.0 37 461.0 38 702.0 39 1805.0 40 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.5479109331999 10.958218663997998 9.55716787590693 48.93670252689517 2 19.7 14.95 39.625 25.724999999999998 3 20.200000000000003 19.325 25.95 34.525 4 24.275 28.475 22.875 24.375 5 23.625 30.75 25.2 20.424999999999997 6 18.175 31.374999999999996 26.125 24.325 7 16.725 21.875 40.6 20.8 8 18.8 21.2 30.675 29.325000000000003 9 18.275 20.775 31.474999999999998 29.475 10 19.85 35.825 23.7 20.625 11 23.474999999999998 25.874999999999996 21.375 29.275000000000002 12 22.125 21.875 27.224999999999998 28.775000000000002 13 20.825 26.5 27.700000000000003 24.975 14 21.05 24.9 27.450000000000003 26.6 15 20.95 24.85 27.650000000000002 26.55 16 22.15 25.75 26.1 26.0 17 21.625 24.55 27.575 26.25 18 21.65 25.124999999999996 26.200000000000003 27.025 19 21.525 26.275 27.425 24.775 20 22.075 25.974999999999998 26.8 25.15 21 21.2 25.05 26.650000000000002 27.1 22 21.8 26.025 26.924999999999997 25.25 23 21.425 25.724999999999998 28.125 24.725 24 20.985492746373186 25.03751875937969 27.688844422211105 26.28814407203602 25 21.7 25.924999999999997 25.474999999999998 26.900000000000002 26 21.725 26.025 26.450000000000003 25.8 27 20.974999999999998 24.925 27.575 26.525 28 21.6 25.7 26.400000000000002 26.3 29 21.775 25.124999999999996 25.95 27.150000000000002 30 22.0 23.95 26.55 27.500000000000004 31 20.95 26.0 25.95 27.1 32 22.95 25.124999999999996 26.3 25.624999999999996 33 22.3 24.175 27.025 26.5 34 21.8 26.05 25.35 26.8 35 22.475 25.15 26.400000000000002 25.974999999999998 36 22.675 24.025 26.025 27.275 37 22.7 26.200000000000003 25.775 25.324999999999996 38 23.0 23.724999999999998 27.250000000000004 26.025 39 20.575 24.95 25.924999999999997 28.549999999999997 40 21.4 24.85 27.0 26.75 41 21.275 24.55 26.775 27.400000000000002 42 21.85 24.625 27.1 26.424999999999997 43 21.55 25.2 27.675 25.575 44 21.525 24.675 27.375 26.424999999999997 45 21.2 25.900000000000002 26.6 26.3 46 22.27227227227227 24.424424424424423 26.2012012012012 27.102102102102105 47 22.47247247247247 24.824824824824827 26.351351351351347 26.351351351351347 48 21.866399799849887 24.768576432324245 26.394796097072803 26.970227670753065 49 21.375 25.35 25.525 27.750000000000004 50 21.07107107107107 25.75075075075075 24.8998998998999 28.27827827827828 51 21.325 23.9 26.825 27.950000000000003 52 22.55 25.650000000000002 26.1 25.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 1.0 19 0.0 20 2.0 21 4.0 22 3.5 23 3.0 24 7.5 25 12.0 26 15.5 27 19.0 28 21.5 29 24.0 30 33.0 31 42.0 32 50.0 33 58.0 34 68.0 35 78.0 36 90.5 37 103.0 38 128.5 39 184.0 40 214.0 41 234.5 42 255.0 43 288.5 44 322.0 45 357.0 46 392.0 47 400.0 48 408.0 49 395.0 50 382.0 51 384.0 52 386.0 53 360.5 54 335.0 55 300.0 56 265.0 57 219.0 58 173.0 59 142.5 60 112.0 61 104.0 62 96.0 63 81.5 64 52.5 65 38.0 66 27.0 67 16.0 68 15.5 69 15.0 70 12.0 71 9.0 72 9.5 73 10.0 74 6.0 75 2.0 76 2.5 77 3.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.05 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.1 47 0.1 48 0.075 49 0.0 50 0.1 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09159727479182 98.175 2 0.8831693161746152 1.7500000000000002 3 0.025233409033560434 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143139 spots for SRR5423470.sra Written 143139 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra Read 143135 spots for SRR5423470.sra Written 143135 spots for SRR5423470.sra SRR ids: ['SRR5423470.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pmmb09cx SRR5423470.sra spots: 2862704 blocks: [[1, 143135], [143136, 286270], [286271, 429405], [429406, 572540], [572541, 715675], [715676, 858810], [858811, 1001945], [1001946, 1145080], [1145081, 1288215], [1288216, 1431350], [1431351, 1574485], [1574486, 1717620], [1717621, 1860755], [1860756, 2003890], [2003891, 2147025], [2147026, 2290160], [2290161, 2433295], [2433296, 2576430], [2576431, 2719565], [2719566, 2862704]] SRR5423470 file size 503503 SRR5423470 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423470 SRR5423470_1.fastq Input file: SRR5423470_1.fastq trimmed: SRR5423470-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:48:00 2025 >> started Wed Feb 12 15:48:01 2025 >> done (1.574s) 2862704 reads processed; of these: 121 ( 0.00%) short reads filtered out after trimming by size control 145 ( 0.01%) empty reads filtered out after trimming by size control 2862438 (99.99%) reads available; of these: 35170 ( 1.23%) trimmed reads available after processing 2827268 (98.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 3 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 0 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 0 0.00% 30 2 0.00% 31 1 0.00% 32 5 0.00% 33 9 0.00% 34 3 0.00% 35 11 0.00% 36 10 0.00% 37 14 0.00% 38 9 0.00% 39 13 0.00% 40 17 0.00% 41 22 0.00% 42 38 0.00% 43 42 0.00% 44 75 0.00% 45 99 0.00% 46 134 0.00% 47 226 0.01% 48 474 0.02% 49 1044 0.04% 50 3695 0.13% 51 29212 1.02% 52 2827268 98.77% 2862438 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=25 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=161.20 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=20.6 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:48:13 Started mapping on | Feb 12 15:48:13 Finished on | Feb 12 15:48:19 Mapping speed, Million of reads per hour | 1717.46 Number of input reads | 2862438 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2574872 Uniquely mapped reads % | 89.95% Average mapped length | 51.85 Number of splices: Total | 338264 Number of splices: Annotated (sjdb) | 334516 Number of splices: GT/AG | 332072 Number of splices: GC/AG | 5561 Number of splices: AT/AC | 250 Number of splices: Non-canonical | 381 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226073 % of reads mapped to multiple loci | 7.90% Number of reads mapped to too many loci | 52316 % of reads mapped to too many loci | 1.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.32% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 61493 61493 61493 N_multimapping 226073 226073 226073 N_noFeature 75503 2552037 84291 N_ambiguous 23979 35 9916 UnstrandedReadsAssigned:2475390 PositiveStrandReadsAssigned:22800 NegativeStrandReadsAssigned:2480665 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423470 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423470-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,862,438 reads, 2,649,251 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR5423470.ke.tsv 34699 SRR5423470.se.tsv 87100 total ==> SRR5423470.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 47 10.2559 Potri.005G024800.1.v4.1 1035 936 1 0.447379 Potri.004G059700.1.v4.1 961 862 10 4.85785 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 38.7172 5.70067 Potri.016G087400.1.v4.1 270 171 144 352.629 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.250147 Potri.012G127500.1.v4.1 977 878 141 67.2474 ==> SRR5423470.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 47 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423470 completed mapping pipeline successfully