Starting /dee2/code/volunteer_pipeline.sh SRR5423471 current disk space = 3051984674816 free memory = 1579895060 SRR5423471 SRAfilesize a8f3c5bdd2ac7ff3a0af1c8f192576e5 SRR5423471.sra SRR5423471.sra file validated SRR5423471 is single end SRR5423471 is conventional basespace SRR5423471 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423471_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.58125 34.0 31.0 34.0 28.0 34.0 2 31.70175 34.0 31.0 34.0 27.0 34.0 3 32.59575 34.0 31.0 34.0 30.0 34.0 4 36.13675 37.0 35.0 37.0 35.0 37.0 5 36.1315 37.0 37.0 37.0 35.0 37.0 6 36.29825 37.0 37.0 37.0 35.0 37.0 7 36.29425 37.0 37.0 37.0 35.0 37.0 8 36.249 37.0 37.0 37.0 35.0 37.0 9 37.98525 39.0 38.0 39.0 35.0 39.0 10 38.047 39.0 38.0 39.0 35.0 39.0 11 38.067 39.0 38.0 39.0 37.0 39.0 12 37.991 39.0 38.0 39.0 35.0 39.0 13 37.93475 39.0 38.0 39.0 35.0 39.0 14 39.5645 41.0 40.0 41.0 37.0 41.0 15 39.5215 41.0 39.0 41.0 37.0 41.0 16 39.3655 41.0 39.0 41.0 36.0 41.0 17 39.283 41.0 39.0 41.0 36.0 41.0 18 39.49525 41.0 39.0 41.0 37.0 41.0 19 39.445 41.0 39.0 41.0 36.0 41.0 20 39.43775 41.0 39.0 41.0 36.0 41.0 21 39.29875 41.0 39.0 41.0 36.0 41.0 22 39.38125 41.0 39.0 41.0 36.0 41.0 23 39.32025 40.0 39.0 41.0 36.0 41.0 24 39.38025 41.0 39.0 41.0 36.0 41.0 25 39.3005 41.0 39.0 41.0 36.0 41.0 26 39.268 41.0 39.0 41.0 36.0 41.0 27 39.2525 41.0 39.0 41.0 36.0 41.0 28 39.195 41.0 39.0 41.0 36.0 41.0 29 39.174 41.0 39.0 41.0 36.0 41.0 30 39.07525 41.0 39.0 41.0 36.0 41.0 31 39.0925 41.0 39.0 41.0 36.0 41.0 32 38.97675 40.0 39.0 41.0 35.0 41.0 33 38.9945 40.0 39.0 41.0 35.0 41.0 34 39.064 40.0 39.0 41.0 36.0 41.0 35 39.0375 40.0 39.0 41.0 35.0 41.0 36 38.843 40.0 39.0 41.0 35.0 41.0 37 38.84225 40.0 39.0 41.0 35.0 41.0 38 38.705 40.0 38.0 41.0 35.0 41.0 39 38.5675 40.0 38.0 41.0 35.0 41.0 40 38.612 40.0 38.0 41.0 34.0 41.0 41 38.59275 40.0 38.0 41.0 35.0 41.0 42 38.419 40.0 38.0 41.0 34.0 41.0 43 38.43 40.0 38.0 41.0 34.0 41.0 44 38.4035 40.0 38.0 41.0 34.0 41.0 45 38.16875 40.0 38.0 41.0 34.0 41.0 46 38.1585 40.0 38.0 41.0 33.0 41.0 47 37.94875 40.0 38.0 41.0 33.0 41.0 48 37.9935 40.0 38.0 41.0 33.0 41.0 49 37.98925 40.0 38.0 41.0 33.0 41.0 50 37.74075 40.0 37.0 41.0 33.0 41.0 51 37.64775 40.0 37.0 41.0 32.0 41.0 52 36.18075 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 1.0 23 4.0 24 4.0 25 4.0 26 11.0 27 19.0 28 19.0 29 22.0 30 34.0 31 41.0 32 53.0 33 85.0 34 122.0 35 135.0 36 211.0 37 373.0 38 812.0 39 2035.0 40 11.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.055241174885474 13.096200485044463 6.4672594987873895 35.38129884128267 2 22.6 16.650000000000002 35.8 24.95 3 18.4 22.425 27.075 32.1 4 23.075000000000003 28.999999999999996 23.674999999999997 24.25 5 23.549999999999997 32.175 23.549999999999997 20.724999999999998 6 19.275000000000002 33.925 23.875 22.925 7 15.575 23.175 40.6 20.65 8 19.175 20.549999999999997 29.4 30.875000000000004 9 18.475 20.325 32.05 29.15 10 19.900000000000002 36.325 23.9 19.875 11 24.975 25.275 21.425 28.325 12 23.45 21.6 26.775 28.175 13 20.9 26.400000000000002 27.925 24.775 14 21.325 25.0 28.075 25.6 15 20.95 24.65 28.025 26.375 16 21.325 26.325 27.3 25.05 17 23.05 24.349999999999998 26.724999999999998 25.874999999999996 18 22.475 24.15 26.150000000000002 27.224999999999998 19 20.95 26.525 26.5 26.025 20 21.475 25.4 26.35 26.775 21 21.825 25.35 26.724999999999998 26.1 22 22.675 26.174999999999997 26.125 25.025 23 21.3 25.775 27.474999999999998 25.45 24 22.0 24.55 25.7 27.750000000000004 25 22.075 26.400000000000002 25.424999999999997 26.1 26 22.325 26.075 25.5 26.1 27 22.025 25.95 25.374999999999996 26.650000000000002 28 21.8 26.625 25.1 26.474999999999998 29 21.2 26.5 25.174999999999997 27.125 30 20.25 25.474999999999998 26.5 27.775 31 21.175 26.75 26.5 25.575 32 22.325 24.525 26.35 26.8 33 22.025 23.525 26.775 27.675 34 22.35 26.200000000000003 25.974999999999998 25.474999999999998 35 21.4 24.775 25.775 28.050000000000004 36 21.4 24.925 26.224999999999998 27.450000000000003 37 22.875 26.275 25.474999999999998 25.374999999999996 38 22.75 24.725 26.525 26.0 39 20.825 24.375 27.575 27.224999999999998 40 21.725 26.6 25.924999999999997 25.75 41 22.125 25.575 25.474999999999998 26.825 42 21.625 25.275 26.35 26.75 43 22.675 25.95 26.150000000000002 25.224999999999998 44 22.3 24.325 26.1 27.275 45 21.175 24.6 26.474999999999998 27.750000000000004 46 22.3 26.025 24.95 26.724999999999998 47 22.35 24.375 27.175 26.1 48 21.825 25.15 25.45 27.575 49 23.150000000000002 25.424999999999997 25.95 25.474999999999998 50 22.080520130032507 25.93148287071768 25.85646411602901 26.131532883220803 51 22.425 23.575 26.174999999999997 27.825 52 22.925 24.375 25.974999999999998 26.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 1.5 17 3.0 18 3.0 19 3.0 20 3.0 21 3.0 22 6.0 23 9.0 24 8.0 25 7.0 26 11.0 27 15.0 28 26.5 29 38.0 30 41.5 31 45.0 32 50.5 33 56.0 34 74.5 35 93.0 36 95.5 37 98.0 38 124.5 39 185.5 40 220.0 41 246.5 42 273.0 43 282.5 44 292.0 45 315.0 46 338.0 47 379.5 48 421.0 49 391.0 50 361.0 51 376.0 52 391.0 53 384.0 54 377.0 55 314.5 56 252.0 57 204.5 58 157.0 59 146.0 60 135.0 61 119.5 62 104.0 63 78.5 64 44.0 65 35.0 66 30.5 67 26.0 68 19.0 69 12.0 70 11.0 71 10.0 72 10.0 73 10.0 74 7.5 75 5.0 76 3.0 77 1.0 78 2.0 79 3.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7564296520423601 1.5 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra Read 200000 spots for SRR5423471.sra Written 200000 spots for SRR5423471.sra SRR ids: ['SRR5423471.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jm23nt1b SRR5423471.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423471 file size 703982 SRR5423471 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423471 SRR5423471_1.fastq Input file: SRR5423471_1.fastq trimmed: SRR5423471-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:16:07 2025 >> started Wed Feb 12 16:16:09 2025 >> done (1.966s) 4000000 reads processed; of these: 204 ( 0.01%) short reads filtered out after trimming by size control 112 ( 0.00%) empty reads filtered out after trimming by size control 3999684 (99.99%) reads available; of these: 59390 ( 1.48%) trimmed reads available after processing 3940294 (98.52%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 5 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 3 0.00% 26 3 0.00% 27 2 0.00% 28 3 0.00% 29 6 0.00% 30 11 0.00% 31 16 0.00% 32 14 0.00% 33 18 0.00% 34 16 0.00% 35 22 0.00% 36 29 0.00% 37 37 0.00% 38 34 0.00% 39 50 0.00% 40 69 0.00% 41 96 0.00% 42 92 0.00% 43 121 0.00% 44 185 0.00% 45 269 0.01% 46 421 0.01% 47 565 0.01% 48 1011 0.03% 49 2130 0.05% 50 6096 0.15% 51 48053 1.20% 52 3940294 98.52% 3999684 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=27 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=10 fanout-score=145.53 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=18.9 sequence=CTTCTTCTTCTC Started job on | Feb 12 16:16:22 Started mapping on | Feb 12 16:16:22 Finished on | Feb 12 16:16:26 Mapping speed, Million of reads per hour | 3599.72 Number of input reads | 3999684 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3590728 Uniquely mapped reads % | 89.78% Average mapped length | 51.85 Number of splices: Total | 452585 Number of splices: Annotated (sjdb) | 447482 Number of splices: GT/AG | 445496 Number of splices: GC/AG | 6325 Number of splices: AT/AC | 308 Number of splices: Non-canonical | 456 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315152 % of reads mapped to multiple loci | 7.88% Number of reads mapped to too many loci | 80082 % of reads mapped to too many loci | 2.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 93804 93804 93804 N_multimapping 315152 315152 315152 N_noFeature 108942 3557144 121976 N_ambiguous 35652 64 15062 UnstrandedReadsAssigned:3446134 PositiveStrandReadsAssigned:33520 NegativeStrandReadsAssigned:3453690 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423471 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423471-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,684 reads, 3,695,216 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR5423471.ke.tsv 34699 SRR5423471.se.tsv 87100 total ==> SRR5423471.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 60 9.50319 Potri.005G024800.1.v4.1 1035 936 5 1.62363 Potri.004G059700.1.v4.1 961 862 6 2.11562 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 44.8869 4.79715 Potri.016G087400.1.v4.1 270 171 163 289.724 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.181567 Potri.012G127500.1.v4.1 977 878 179 61.9658 ==> SRR5423471.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 97 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423471 completed mapping pipeline successfully