Starting /dee2/code/volunteer_pipeline.sh SRR5423472 current disk space = 3051723976704 free memory = 1469068724 SRR5423472 SRAfilesize 689f35de2d78c81d0fa5cc96178f1e87 SRR5423472.sra SRR5423472.sra file validated SRR5423472 is single end SRR5423472 is conventional basespace SRR5423472 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423472_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.30525 31.0 31.0 34.0 28.0 34.0 2 31.774 31.0 31.0 34.0 30.0 34.0 3 31.92 33.0 31.0 34.0 30.0 34.0 4 33.16625 35.0 33.0 37.0 25.0 37.0 5 34.89975 37.0 35.0 37.0 32.0 37.0 6 35.2565 37.0 35.0 37.0 32.0 37.0 7 35.50575 37.0 35.0 37.0 33.0 37.0 8 35.51175 37.0 35.0 37.0 33.0 37.0 9 37.3255 39.0 37.0 39.0 34.0 39.0 10 37.23025 39.0 37.0 39.0 34.0 39.0 11 37.2215 39.0 37.0 39.0 34.0 39.0 12 37.211 39.0 37.0 39.0 33.0 39.0 13 37.12475 39.0 37.0 39.0 33.0 39.0 14 38.33475 40.0 38.0 41.0 33.0 41.0 15 38.33875 40.0 38.0 41.0 33.0 41.0 16 38.32375 40.0 38.0 41.0 33.0 41.0 17 38.31625 40.0 38.0 41.0 33.0 41.0 18 38.338 40.0 38.0 41.0 33.0 41.0 19 38.443 40.0 38.0 41.0 34.0 41.0 20 38.3545 40.0 38.0 41.0 34.0 41.0 21 38.399 40.0 38.0 41.0 34.0 41.0 22 38.42725 40.0 38.0 41.0 34.0 41.0 23 38.357 40.0 38.0 41.0 34.0 41.0 24 38.34125 40.0 38.0 41.0 33.0 41.0 25 38.42375 40.0 38.0 41.0 34.0 41.0 26 38.399 40.0 38.0 41.0 34.0 41.0 27 38.213 40.0 38.0 41.0 33.0 41.0 28 38.1265 40.0 38.0 41.0 33.0 41.0 29 38.0845 40.0 38.0 41.0 34.0 41.0 30 38.099 40.0 38.0 41.0 33.0 41.0 31 37.97625 40.0 37.0 41.0 33.0 41.0 32 37.92725 40.0 37.0 41.0 33.0 41.0 33 37.88075 40.0 37.0 41.0 33.0 41.0 34 38.0805 40.0 38.0 41.0 33.0 41.0 35 38.01475 40.0 37.0 41.0 33.0 41.0 36 37.863 40.0 37.0 41.0 33.0 41.0 37 38.00825 40.0 37.0 41.0 33.0 41.0 38 37.77275 40.0 37.0 41.0 32.0 41.0 39 37.733 40.0 37.0 41.0 32.0 41.0 40 37.6415 40.0 37.0 41.0 32.0 41.0 41 37.551 40.0 37.0 41.0 32.0 41.0 42 37.56025 40.0 37.0 41.0 31.0 41.0 43 37.385 40.0 37.0 41.0 31.0 41.0 44 37.427 40.0 37.0 41.0 32.0 41.0 45 37.5155 40.0 37.0 41.0 32.0 41.0 46 37.431 40.0 36.0 41.0 31.0 41.0 47 37.36625 39.0 36.0 41.0 31.0 41.0 48 37.32675 40.0 36.0 41.0 31.0 41.0 49 36.983 39.0 36.0 41.0 31.0 41.0 50 37.00625 39.0 36.0 41.0 31.0 41.0 51 36.91 39.0 35.0 41.0 30.0 41.0 52 36.253 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1114 1 0.0 1114 2 0.0 1114 3 0.0 1114 4 0.0 1114 5 0.0 1114 6 0.0 1114 7 0.0 1114 8 0.0 1114 9 0.0 1114 10 0.0 1114 11 0.0 1114 12 0.0 1114 13 0.0 1114 14 0.0 1114 15 0.0 1114 16 0.0 1114 17 0.0 1114 18 0.0 1114 19 0.0 1114 20 0.0 1114 21 0.0 1114 22 0.0 1114 23 0.0 1114 24 0.0 1114 25 0.0 1114 26 0.0 1114 27 0.0 1114 28 0.0 1114 29 0.0 1114 30 0.0 1114 31 0.0 1114 32 0.0 1114 33 0.0 1114 34 0.0 1114 35 0.0 1114 36 0.0 1114 37 0.0 1114 38 0.0 1114 39 0.0 1114 40 0.0 1114 41 0.0 1114 42 0.0 1114 43 0.0 1114 44 0.0 1114 45 0.0 1114 46 0.0 1114 47 0.0 1114 48 0.0 1114 49 0.0 1114 50 0.0 1114 51 0.0 1114 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 2.0 21 1.0 22 4.0 23 4.0 24 9.0 25 13.0 26 13.0 27 29.0 28 39.0 29 44.0 30 78.0 31 72.0 32 127.0 33 132.0 34 180.0 35 242.0 36 341.0 37 444.0 38 765.0 39 1451.0 40 7.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.47608314550463 15.251690458302027 5.634861006761834 35.63736538943151 2 21.2 16.775000000000002 35.699999999999996 26.325 3 18.875 21.25 27.6 32.275 4 22.675 29.025000000000002 25.525 22.775000000000002 5 23.549999999999997 32.475 23.425 20.549999999999997 6 19.7 32.175 24.349999999999998 23.775 7 16.625 22.75 40.8 19.825 8 17.0 21.825 30.625000000000004 30.55 9 17.925 20.075000000000003 32.775 29.225 10 19.575 36.1 23.7 20.625 11 23.825 27.200000000000003 21.05 27.925 12 21.875 22.675 26.35 29.099999999999998 13 21.5 26.35 26.424999999999997 25.724999999999998 14 20.7 25.474999999999998 27.650000000000002 26.174999999999997 15 20.175 26.075 27.525 26.224999999999998 16 21.2 26.025 26.174999999999997 26.6 17 21.775 25.275 26.85 26.1 18 20.175 25.15 26.700000000000003 27.975 19 22.5 25.75 26.424999999999997 25.324999999999996 20 21.825 25.0 27.575 25.6 21 20.8 24.75 29.299999999999997 25.15 22 21.425 26.424999999999997 25.75 26.400000000000002 23 21.45 24.85 26.825 26.875 24 21.4 25.35 26.55 26.700000000000003 25 22.2 25.174999999999997 26.275 26.35 26 21.9 25.900000000000002 27.025 25.174999999999997 27 21.325 24.65 27.1 26.924999999999997 28 21.125 26.275 26.174999999999997 26.424999999999997 29 21.575 25.775 27.3 25.35 30 21.25 25.0 25.775 27.975 31 21.875 27.725 24.8 25.6 32 21.875 25.3 27.650000000000002 25.174999999999997 33 21.475 25.75 25.95 26.825 34 21.099999999999998 26.05 26.974999999999998 25.874999999999996 35 22.3 23.9 27.325 26.474999999999998 36 20.825 24.975 26.35 27.85 37 21.425 26.25 25.124999999999996 27.200000000000003 38 22.45 26.0 26.650000000000002 24.9 39 21.625 24.15 26.674999999999997 27.55 40 22.175 25.174999999999997 25.275 27.375 41 22.400000000000002 25.3 25.7 26.6 42 22.15 24.6 26.525 26.724999999999998 43 21.475 25.974999999999998 25.45 27.1 44 21.6 25.324999999999996 26.8 26.275 45 21.349999999999998 24.9 26.55 27.200000000000003 46 22.3 25.35 26.200000000000003 26.150000000000002 47 22.650000000000002 25.275 25.724999999999998 26.35 48 22.425 23.674999999999997 25.95 27.950000000000003 49 23.125 26.275 25.45 25.15 50 22.95 25.275 26.325 25.45 51 20.75 24.55 26.525 28.175 52 23.525 25.95 25.3 25.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 4.0 20 4.0 21 4.0 22 5.0 23 6.0 24 7.5 25 9.0 26 13.0 27 17.0 28 21.0 29 25.0 30 42.0 31 59.0 32 62.0 33 65.0 34 77.0 35 89.0 36 97.0 37 105.0 38 126.5 39 183.5 40 219.0 41 243.0 42 267.0 43 300.0 44 333.0 45 356.5 46 380.0 47 390.0 48 400.0 49 375.0 50 350.0 51 359.0 52 368.0 53 347.0 54 326.0 55 295.5 56 265.0 57 223.5 58 182.0 59 164.5 60 147.0 61 119.5 62 92.0 63 70.5 64 43.0 65 37.0 66 29.0 67 21.0 68 19.0 69 17.0 70 11.0 71 5.0 72 3.5 73 2.0 74 3.5 75 5.0 76 3.0 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7312153303076148 1.4500000000000002 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra Read 200000 spots for SRR5423472.sra Written 200000 spots for SRR5423472.sra SRR ids: ['SRR5423472.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_25l7piod SRR5423472.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423472 file size 703967 SRR5423472 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423472 SRR5423472_1.fastq Input file: SRR5423472_1.fastq trimmed: SRR5423472-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:38:46 2025 >> started Wed Feb 12 15:38:48 2025 >> done (1.662s) 4000000 reads processed; of these: 230 ( 0.01%) short reads filtered out after trimming by size control 99 ( 0.00%) empty reads filtered out after trimming by size control 3999671 (99.99%) reads available; of these: 60230 ( 1.51%) trimmed reads available after processing 3939441 (98.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 3 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 4 0.00% 27 5 0.00% 28 8 0.00% 29 6 0.00% 30 4 0.00% 31 17 0.00% 32 17 0.00% 33 13 0.00% 34 12 0.00% 35 14 0.00% 36 30 0.00% 37 43 0.00% 38 43 0.00% 39 43 0.00% 40 68 0.00% 41 109 0.00% 42 115 0.00% 43 139 0.00% 44 188 0.00% 45 272 0.01% 46 430 0.01% 47 691 0.02% 48 1048 0.03% 49 2276 0.06% 50 6612 0.17% 51 48003 1.20% 52 3939441 98.49% 3999671 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=29 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=11 fanout-score=148.46 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=19.3 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:39:01 Started mapping on | Feb 12 15:39:01 Finished on | Feb 12 15:39:06 Mapping speed, Million of reads per hour | 2879.76 Number of input reads | 3999671 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3592084 Uniquely mapped reads % | 89.81% Average mapped length | 51.85 Number of splices: Total | 452679 Number of splices: Annotated (sjdb) | 447501 Number of splices: GT/AG | 445427 Number of splices: GC/AG | 6380 Number of splices: AT/AC | 349 Number of splices: Non-canonical | 523 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313960 % of reads mapped to multiple loci | 7.85% Number of reads mapped to too many loci | 79881 % of reads mapped to too many loci | 2.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 93627 93627 93627 N_multimapping 313960 313960 313960 N_noFeature 109450 3558170 122604 N_ambiguous 35905 54 15110 UnstrandedReadsAssigned:3446729 PositiveStrandReadsAssigned:33860 NegativeStrandReadsAssigned:3454370 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423472 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423472-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,671 reads, 3,696,180 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR5423472.ke.tsv 34699 SRR5423472.se.tsv 87100 total ==> SRR5423472.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 60 9.50562 Potri.005G024800.1.v4.1 1035 936 5 1.62405 Potri.004G059700.1.v4.1 961 862 8 2.82154 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 39.3861 4.21034 Potri.016G087400.1.v4.1 270 171 147 261.352 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.181614 Potri.012G127500.1.v4.1 977 878 153 52.9787 ==> SRR5423472.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 74 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423472 completed mapping pipeline successfully