Starting /dee2/code/volunteer_pipeline.sh SRR5423473 current disk space = 3051718860800 free memory = 1494795180 SRR5423473 SRAfilesize d23614e60fc22d8e8f23f904cc03e6ba SRR5423473.sra SRR5423473.sra file validated SRR5423473 is single end SRR5423473 is conventional basespace SRR5423473 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423473_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69975 33.0 31.0 34.0 30.0 34.0 2 32.059 33.0 31.0 34.0 30.0 34.0 3 32.2475 34.0 31.0 34.0 30.0 34.0 4 33.5605 37.0 33.0 37.0 26.0 37.0 5 35.27675 37.0 35.0 37.0 32.0 37.0 6 35.5445 37.0 35.0 37.0 33.0 37.0 7 35.69775 37.0 35.0 37.0 33.0 37.0 8 35.75025 37.0 35.0 37.0 35.0 37.0 9 37.4855 39.0 37.0 39.0 34.0 39.0 10 37.45525 39.0 37.0 39.0 35.0 39.0 11 37.58875 39.0 37.0 39.0 35.0 39.0 12 37.35425 39.0 37.0 39.0 34.0 39.0 13 37.32575 39.0 37.0 39.0 34.0 39.0 14 38.633 40.0 38.0 41.0 34.0 41.0 15 38.687 40.0 38.0 41.0 35.0 41.0 16 38.793 40.0 38.0 41.0 35.0 41.0 17 38.8345 40.0 38.0 41.0 35.0 41.0 18 38.8305 40.0 38.0 41.0 35.0 41.0 19 38.8215 40.0 38.0 41.0 34.0 41.0 20 38.6895 40.0 38.0 41.0 34.0 41.0 21 38.701 40.0 38.0 41.0 35.0 41.0 22 38.645 40.0 38.0 41.0 34.0 41.0 23 38.63375 40.0 38.0 41.0 34.0 41.0 24 38.7135 40.0 38.0 41.0 34.0 41.0 25 38.65625 40.0 38.0 41.0 34.0 41.0 26 38.23175 40.0 38.0 41.0 33.0 41.0 27 38.41025 40.0 38.0 41.0 34.0 41.0 28 38.45125 40.0 38.0 41.0 34.0 41.0 29 38.58325 40.0 38.0 41.0 34.0 41.0 30 38.4365 40.0 38.0 41.0 34.0 41.0 31 38.4465 40.0 38.0 41.0 34.0 41.0 32 38.417 40.0 38.0 41.0 34.0 41.0 33 38.47725 40.0 38.0 41.0 34.0 41.0 34 38.4345 40.0 38.0 41.0 34.0 41.0 35 38.42475 40.0 38.0 41.0 34.0 41.0 36 38.21525 40.0 38.0 41.0 33.0 41.0 37 38.33275 40.0 38.0 41.0 34.0 41.0 38 38.2975 40.0 38.0 41.0 34.0 41.0 39 38.1845 40.0 38.0 41.0 33.0 41.0 40 38.08725 40.0 38.0 41.0 33.0 41.0 41 38.018 40.0 37.0 41.0 33.0 41.0 42 37.94175 40.0 37.0 41.0 33.0 41.0 43 37.91725 40.0 37.0 41.0 33.0 41.0 44 37.983 40.0 37.0 41.0 33.0 41.0 45 37.87325 40.0 37.0 41.0 33.0 41.0 46 37.66375 40.0 37.0 41.0 32.0 41.0 47 37.82875 40.0 37.0 41.0 33.0 41.0 48 37.5515 40.0 36.0 41.0 32.0 41.0 49 37.59025 40.0 37.0 41.0 32.0 41.0 50 37.5675 40.0 37.0 41.0 32.0 41.0 51 37.57675 40.0 36.0 41.0 32.0 41.0 52 36.57075 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1212 1 0.0 1212 2 0.0 1212 3 0.0 1212 4 0.0 1212 5 0.0 1212 6 0.0 1212 7 0.0 1212 8 0.0 1212 9 0.0 1212 10 0.0 1212 11 0.0 1212 12 0.0 1212 13 0.0 1212 14 0.0 1212 15 0.0 1212 16 0.0 1212 17 0.0 1212 18 0.0 1212 19 0.0 1212 20 0.0 1212 21 0.0 1212 22 0.0 1212 23 0.0 1212 24 0.0 1212 25 0.0 1212 26 0.0 1212 27 0.0 1212 28 0.0 1212 29 0.0 1212 30 0.0 1212 31 0.0 1212 32 0.0 1212 33 0.0 1212 34 0.0 1212 35 0.0 1212 36 0.0 1212 37 0.0 1212 38 0.0 1212 39 0.0 1212 40 0.0 1212 41 0.0 1212 42 0.0 1212 43 0.0 1212 44 0.0 1212 45 0.0 1212 46 0.0 1212 47 0.0 1212 48 0.0 1212 49 0.0 1212 50 0.0 1212 51 0.0 1212 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 2.0 23 3.0 24 2.0 25 7.0 26 14.0 27 21.0 28 25.0 29 42.0 30 54.0 31 76.0 32 71.0 33 125.0 34 186.0 35 209.0 36 306.0 37 425.0 38 738.0 39 1683.0 40 8.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.87853744052091 13.949411470072626 5.935386927122464 35.236664162284 2 21.275 17.599999999999998 36.025 25.1 3 19.7 21.75 27.750000000000004 30.8 4 23.549999999999997 28.275 24.975 23.200000000000003 5 22.125 33.475 23.849999999999998 20.549999999999997 6 20.0 33.15 22.925 23.925 7 15.825 22.45 42.025 19.7 8 18.475 21.75 30.85 28.925 9 18.45 19.35 33.050000000000004 29.15 10 21.75 34.575 23.275000000000002 20.4 11 23.45 25.025 21.875 29.65 12 22.0 21.825 26.3 29.875 13 21.625 24.85 28.15 25.374999999999996 14 20.75 25.674999999999997 27.800000000000004 25.775 15 21.525 24.825 27.375 26.275 16 22.95 24.675 26.35 26.025 17 21.625 25.624999999999996 26.575 26.174999999999997 18 21.575 24.875 27.125 26.424999999999997 19 22.650000000000002 27.0 25.2 25.15 20 22.2 25.4 26.700000000000003 25.7 21 21.25 24.65 25.85 28.249999999999996 22 22.95 26.450000000000003 24.3 26.3 23 23.0 25.05 27.0 24.95 24 21.65 23.724999999999998 28.050000000000004 26.575 25 22.625 24.975 25.650000000000002 26.75 26 22.625 26.924999999999997 25.424999999999997 25.025 27 21.15 25.5 26.025 27.325 28 22.625 25.4 26.1 25.874999999999996 29 22.75 26.8 25.424999999999997 25.025 30 21.95 25.05 27.200000000000003 25.8 31 22.55 27.0 25.7 24.75 32 22.5 24.6 27.025 25.874999999999996 33 21.525 24.125 25.7 28.65 34 21.7 25.75 26.650000000000002 25.900000000000002 35 22.375 24.099999999999998 26.55 26.974999999999998 36 21.6 25.85 26.8 25.75 37 22.8 24.6 25.324999999999996 27.275 38 22.775000000000002 24.349999999999998 27.250000000000004 25.624999999999996 39 21.375 24.6 25.95 28.075 40 21.425 26.125 25.775 26.674999999999997 41 22.2 25.324999999999996 26.05 26.424999999999997 42 21.349999999999998 25.525 26.775 26.35 43 21.675 25.35 26.025 26.950000000000003 44 22.375 24.425 27.1 26.1 45 22.400000000000002 23.525 26.900000000000002 27.175 46 22.475 24.8 26.224999999999998 26.5 47 23.599999999999998 23.425 26.400000000000002 26.575 48 21.975 25.25 25.074999999999996 27.700000000000003 49 22.725 25.25 24.925 27.1 50 21.625 25.374999999999996 27.575 25.424999999999997 51 20.75 24.525 27.474999999999998 27.250000000000004 52 23.674999999999997 25.124999999999996 26.075 25.124999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.5 21 3.0 22 3.5 23 4.0 24 7.5 25 11.0 26 16.5 27 22.0 28 23.0 29 24.0 30 30.5 31 37.0 32 44.5 33 52.0 34 68.0 35 84.0 36 107.0 37 130.0 38 137.5 39 169.5 40 194.0 41 228.0 42 262.0 43 283.5 44 305.0 45 322.5 46 340.0 47 370.5 48 401.0 49 395.5 50 390.0 51 402.5 52 415.0 53 392.0 54 369.0 55 315.5 56 262.0 57 215.5 58 169.0 59 161.5 60 154.0 61 119.0 62 84.0 63 63.5 64 38.5 65 34.0 66 29.0 67 24.0 68 19.5 69 15.0 70 13.0 71 11.0 72 8.5 73 6.0 74 4.0 75 2.0 76 1.5 77 1.0 78 2.0 79 3.0 80 2.0 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96149949341438 97.675 2 0.8865248226950355 1.7500000000000002 3 0.10131712259371835 0.3 4 0.0 0.0 5 0.025329280648429587 0.125 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 6 0.15 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra Read 200000 spots for SRR5423473.sra Written 200000 spots for SRR5423473.sra SRR ids: ['SRR5423473.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1xwr82j8 SRR5423473.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423473 file size 703991 SRR5423473 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423473 SRR5423473_1.fastq Input file: SRR5423473_1.fastq trimmed: SRR5423473-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:40:08 2025 >> started Wed Feb 12 15:40:10 2025 >> done (1.857s) 4000000 reads processed; of these: 222 ( 0.01%) short reads filtered out after trimming by size control 107 ( 0.00%) empty reads filtered out after trimming by size control 3999671 (99.99%) reads available; of these: 57038 ( 1.43%) trimmed reads available after processing 3942633 (98.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 8 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 9 0.00% 26 1 0.00% 27 7 0.00% 28 5 0.00% 29 5 0.00% 30 8 0.00% 31 11 0.00% 32 13 0.00% 33 20 0.00% 34 13 0.00% 35 12 0.00% 36 22 0.00% 37 33 0.00% 38 25 0.00% 39 46 0.00% 40 67 0.00% 41 73 0.00% 42 78 0.00% 43 110 0.00% 44 159 0.00% 45 260 0.01% 46 391 0.01% 47 563 0.01% 48 892 0.02% 49 1964 0.05% 50 5961 0.15% 51 46261 1.16% 52 3942633 98.57% 3999671 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=32 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=9 fanout-score=140.27 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=18.9 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:40:20 Started mapping on | Feb 12 15:40:21 Finished on | Feb 12 15:40:26 Mapping speed, Million of reads per hour | 2879.76 Number of input reads | 3999671 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3592268 Uniquely mapped reads % | 89.81% Average mapped length | 51.85 Number of splices: Total | 452712 Number of splices: Annotated (sjdb) | 447660 Number of splices: GT/AG | 445380 Number of splices: GC/AG | 6451 Number of splices: AT/AC | 381 Number of splices: Non-canonical | 500 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313629 % of reads mapped to multiple loci | 7.84% Number of reads mapped to too many loci | 80080 % of reads mapped to too many loci | 2.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 93774 93774 93774 N_multimapping 313629 313629 313629 N_noFeature 109677 3558465 122800 N_ambiguous 36166 54 15457 UnstrandedReadsAssigned:3446425 PositiveStrandReadsAssigned:33749 NegativeStrandReadsAssigned:3454011 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423473 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423473-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,671 reads, 3,696,135 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR5423473.ke.tsv 34699 SRR5423473.se.tsv 87100 total ==> SRR5423473.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 55 8.72185 Potri.005G024800.1.v4.1 1035 936 2 0.650242 Potri.004G059700.1.v4.1 961 862 5 1.76516 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 37.2243 3.98307 Potri.016G087400.1.v4.1 270 171 161 286.517 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.363576 Potri.012G127500.1.v4.1 977 878 186 64.4673 ==> SRR5423473.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 81 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423473 completed mapping pipeline successfully