Starting /dee2/code/volunteer_pipeline.sh SRR5423474 current disk space = 3051535638528 free memory = 1442474752 SRR5423474 SRAfilesize 9ec815883a7358e6934847917beb7cbf SRR5423474.sra SRR5423474.sra file validated SRR5423474 is single end SRR5423474 is conventional basespace SRR5423474 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423474_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.08375 34.0 31.0 34.0 30.0 34.0 2 32.37275 34.0 31.0 34.0 30.0 34.0 3 32.38525 34.0 31.0 34.0 30.0 34.0 4 35.251 37.0 35.0 37.0 33.0 37.0 5 35.6985 37.0 35.0 37.0 33.0 37.0 6 35.7895 37.0 35.0 37.0 33.0 37.0 7 35.85 37.0 35.0 37.0 35.0 37.0 8 35.8525 37.0 35.0 37.0 35.0 37.0 9 37.47 39.0 37.0 39.0 35.0 39.0 10 37.44175 39.0 37.0 39.0 34.0 39.0 11 37.51525 39.0 37.0 39.0 35.0 39.0 12 37.592 39.0 37.0 39.0 35.0 39.0 13 37.51525 39.0 37.0 39.0 35.0 39.0 14 38.89475 40.0 38.0 41.0 35.0 41.0 15 38.74275 40.0 38.0 41.0 34.0 41.0 16 38.7395 40.0 38.0 41.0 34.0 41.0 17 38.68 40.0 38.0 41.0 35.0 41.0 18 38.60925 40.0 38.0 41.0 34.0 41.0 19 38.8755 40.0 38.0 41.0 35.0 41.0 20 38.7845 40.0 38.0 41.0 34.0 41.0 21 38.724 40.0 38.0 41.0 34.0 41.0 22 38.79925 40.0 38.0 41.0 35.0 41.0 23 38.7985 40.0 38.0 41.0 35.0 41.0 24 38.789 40.0 38.0 41.0 35.0 41.0 25 38.727 40.0 38.0 41.0 34.0 41.0 26 38.68625 40.0 38.0 41.0 34.0 41.0 27 38.652 40.0 38.0 41.0 34.0 41.0 28 38.77625 40.0 38.0 41.0 35.0 41.0 29 38.70775 40.0 38.0 41.0 35.0 41.0 30 38.6095 40.0 38.0 41.0 34.0 41.0 31 38.075 40.0 38.0 41.0 33.0 41.0 32 38.414 40.0 38.0 41.0 34.0 41.0 33 38.35225 40.0 38.0 41.0 34.0 41.0 34 38.29225 40.0 38.0 41.0 34.0 41.0 35 38.42375 40.0 38.0 41.0 34.0 41.0 36 38.3215 40.0 38.0 41.0 34.0 41.0 37 38.2805 40.0 38.0 41.0 33.0 41.0 38 38.217 40.0 38.0 41.0 33.0 41.0 39 38.259 40.0 38.0 41.0 33.0 41.0 40 38.09475 40.0 38.0 41.0 33.0 41.0 41 38.16425 40.0 38.0 41.0 33.0 41.0 42 38.013 40.0 37.0 41.0 33.0 41.0 43 37.987 40.0 37.0 41.0 33.0 41.0 44 38.00875 40.0 37.0 41.0 33.0 41.0 45 37.915 40.0 37.0 41.0 33.0 41.0 46 37.80975 40.0 37.0 41.0 33.0 41.0 47 37.58775 40.0 37.0 41.0 32.0 41.0 48 37.61225 40.0 37.0 41.0 33.0 41.0 49 37.6095 40.0 37.0 41.0 32.0 41.0 50 37.53825 40.0 36.0 41.0 32.0 41.0 51 37.515 40.0 36.0 41.0 32.0 41.0 52 36.549 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1310 1 0.0 1310 2 0.0 1310 3 0.0 1310 4 0.0 1310 5 0.0 1310 6 0.0 1310 7 0.0 1310 8 0.0 1310 9 0.0 1310 10 0.0 1310 11 0.0 1310 12 0.0 1310 13 0.0 1310 14 0.0 1310 15 0.0 1310 16 0.0 1310 17 0.0 1310 18 0.0 1310 19 0.0 1310 20 0.0 1310 21 0.0 1310 22 0.0 1310 23 0.0 1310 24 0.0 1310 25 0.0 1310 26 0.0 1310 27 0.0 1310 28 0.0 1310 29 0.0 1310 30 0.0 1310 31 0.0 1310 32 0.0 1310 33 0.0 1310 34 0.0 1310 35 0.0 1310 36 0.0 1310 37 0.0 1310 38 0.0 1310 39 0.0 1310 40 0.0 1310 41 0.0 1310 42 0.0 1310 43 0.0 1310 44 0.0 1310 45 0.0 1310 46 0.0 1310 47 0.0 1310 48 0.0 1310 49 0.0 1310 50 0.0 1310 51 0.0 1310 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 3.0 23 3.0 24 4.0 25 5.0 26 11.0 27 25.0 28 21.0 29 41.0 30 61.0 31 60.0 32 86.0 33 112.0 34 151.0 35 198.0 36 294.0 37 444.0 38 674.0 39 1791.0 40 14.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.69636135508156 13.42534504391468 6.072772898368884 34.80552070263488 2 22.725 16.75 34.725 25.8 3 17.625 22.5 26.424999999999997 33.45 4 24.25 29.25 22.875 23.625 5 23.45 34.225 21.825 20.5 6 19.175 33.550000000000004 24.825 22.45 7 16.25 20.8 41.125 21.825 8 17.45 21.55 29.95 31.05 9 18.525 20.75 32.225 28.499999999999996 10 20.7 35.9 23.175 20.225 11 24.125 25.05 19.425 31.4 12 22.3 21.85 26.1 29.75 13 20.225 25.674999999999997 28.599999999999998 25.5 14 21.075 25.45 27.500000000000004 25.974999999999998 15 21.2 25.55 27.575 25.674999999999997 16 23.0 26.924999999999997 25.15 24.925 17 22.0 26.075 26.05 25.874999999999996 18 22.075 24.725 27.025 26.174999999999997 19 21.2 25.275 27.650000000000002 25.874999999999996 20 21.625 25.4 26.174999999999997 26.8 21 20.775 26.075 25.85 27.3 22 21.95 25.924999999999997 26.35 25.775 23 22.15 25.45 26.6 25.8 24 22.125 25.275 25.25 27.35 25 23.200000000000003 24.125 26.3 26.375 26 22.375 25.924999999999997 26.1 25.6 27 21.65 24.975 25.974999999999998 27.400000000000002 28 22.900000000000002 26.125 25.5 25.474999999999998 29 21.6 25.4 27.224999999999998 25.775 30 21.224999999999998 24.4 26.950000000000003 27.425 31 21.775 27.125 24.775 26.325 32 22.95 25.4 26.174999999999997 25.474999999999998 33 21.925 24.375 26.55 27.150000000000002 34 23.799999999999997 24.875 25.8 25.525 35 21.8 25.3 27.075 25.825 36 22.45 25.074999999999996 25.650000000000002 26.825 37 23.974999999999998 24.675 25.724999999999998 25.624999999999996 38 23.1 25.025 25.775 26.1 39 24.25 22.650000000000002 25.424999999999997 27.675 40 22.925 26.35 24.6 26.125 41 21.725 26.825 25.324999999999996 26.125 42 23.150000000000002 24.425 25.4 27.025 43 22.230557639409852 25.98149537384346 25.70642660665166 26.081520380095025 44 22.8 24.85 27.575 24.775 45 22.35 25.45 26.5 25.7 46 21.8304576144036 25.881470367591895 27.106776694173547 25.18129532383096 47 24.256064016004 24.18104526131533 26.006501625406354 25.55638909727432 48 22.886443221610804 24.512256128064035 26.113056528264135 26.488244122061033 49 22.0 25.3 26.25 26.450000000000003 50 22.136068034017008 23.911955977988995 27.03851925962982 26.91345672836418 51 21.275 25.1 26.875 26.75 52 21.825 25.825 24.75 27.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.5 19 2.0 20 2.5 21 3.0 22 5.5 23 8.0 24 6.5 25 5.0 26 7.0 27 9.0 28 17.5 29 26.0 30 34.0 31 42.0 32 42.0 33 42.0 34 63.0 35 84.0 36 107.0 37 130.0 38 141.5 39 185.0 40 217.0 41 236.5 42 256.0 43 283.0 44 310.0 45 322.5 46 335.0 47 347.5 48 360.0 49 386.0 50 412.0 51 399.5 52 387.0 53 358.0 54 329.0 55 305.5 56 282.0 57 242.5 58 203.0 59 165.5 60 128.0 61 122.0 62 116.0 63 83.0 64 42.5 65 35.0 66 34.5 67 34.0 68 25.0 69 16.0 70 13.5 71 11.0 72 9.0 73 7.0 74 5.0 75 3.0 76 2.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.025 44 0.0 45 0.0 46 0.025 47 0.025 48 0.05 49 0.0 50 0.05 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83514813876931 97.575 2 1.0888832615852115 2.15 3 0.05064573309698658 0.15 4 0.0 0.0 5 0.02532286654849329 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra Read 200000 spots for SRR5423474.sra Written 200000 spots for SRR5423474.sra SRR ids: ['SRR5423474.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gxuf6jaw SRR5423474.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423474 file size 703973 SRR5423474 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423474 SRR5423474_1.fastq Input file: SRR5423474_1.fastq trimmed: SRR5423474-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:32:52 2025 >> started Wed Feb 12 15:32:54 2025 >> done (1.718s) 4000000 reads processed; of these: 174 ( 0.00%) short reads filtered out after trimming by size control 100 ( 0.00%) empty reads filtered out after trimming by size control 3999726 (99.99%) reads available; of these: 57140 ( 1.43%) trimmed reads available after processing 3942586 (98.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 9 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 6 0.00% 27 2 0.00% 28 7 0.00% 29 3 0.00% 30 6 0.00% 31 12 0.00% 32 17 0.00% 33 16 0.00% 34 15 0.00% 35 15 0.00% 36 21 0.00% 37 44 0.00% 38 31 0.00% 39 43 0.00% 40 62 0.00% 41 84 0.00% 42 89 0.00% 43 122 0.00% 44 196 0.00% 45 269 0.01% 46 368 0.01% 47 550 0.01% 48 982 0.02% 49 2026 0.05% 50 5923 0.15% 51 46202 1.16% 52 3942586 98.57% 3999726 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=65.21 fanout-score-rank=4 prefix-density=0.44 prefix-fanout=12.9 sequence=CTTCTTCTCCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=157.96 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=19.8 sequence=CTTCTTCTTCTC Started job on | Feb 12 15:33:10 Started mapping on | Feb 12 15:33:11 Finished on | Feb 12 15:33:16 Mapping speed, Million of reads per hour | 2879.80 Number of input reads | 3999726 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3591829 Uniquely mapped reads % | 89.80% Average mapped length | 51.85 Number of splices: Total | 452262 Number of splices: Annotated (sjdb) | 447158 Number of splices: GT/AG | 444934 Number of splices: GC/AG | 6458 Number of splices: AT/AC | 353 Number of splices: Non-canonical | 517 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314078 % of reads mapped to multiple loci | 7.85% Number of reads mapped to too many loci | 80037 % of reads mapped to too many loci | 2.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 93819 93819 93819 N_multimapping 314078 314078 314078 N_noFeature 110172 3558065 123082 N_ambiguous 36296 68 15387 UnstrandedReadsAssigned:3445361 PositiveStrandReadsAssigned:33696 NegativeStrandReadsAssigned:3453360 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423474 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423474-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,726 reads, 3,692,764 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR5423474.ke.tsv 34699 SRR5423474.se.tsv 87100 total ==> SRR5423474.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 64 10.1508 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 9 3.17783 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 51.3252 5.49283 Potri.016G087400.1.v4.1 270 171 144 256.308 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.363638 Potri.012G127500.1.v4.1 977 878 184 63.785 ==> SRR5423474.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 72 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423474 completed mapping pipeline successfully